Clone Read LE_HBa0179A02_SP6_125176

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0179A02_SP6_125176
Primer
SP6
ID from Seq. Facility
LE_HBa_179_A02-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
147 trimmed for vector and quality, 970 raw
Sequence
>LE_HBa0179A02_SP6_125176 (raw untrimmed)
CCCCGTTTTTCTCTCATTATGAAGTGACTTAGGGAAAAACCGTTTATGTCCTATGAAGGATGAGAGAAACTTCCATTTTCTAGCTGACATTTTGGGTTGC
GGAGTGGGAAATTGCCCCCTACTTATTCGGGTATTATGAAATACATACAAAGATTTGAAGATATGGGACAACATATTTGAGAGGGGAGAAAAGAGACTAG
CTAGATGGAAGGCTCAGTACATTTCTTTTGGTGGCAGACACCTTCTTATCAGCTCCGTTTTAGACTCTCTCCCAACATATGGTAGGTCTCTTTACACTAT
ACCGGCCGAAGTGGTTAAGACATTGGACAAGCTAGGAGGGATTTCCGTTGGCATGGTTGCAAGAGAGTACAAAGGATACATGGTCCAGTGGGCGACCGTT
TTGCGTAGAAAAGATAAAGGTACATGGTCCAGTGGGCGACAGTTTTGCATAGGAAAGGATAAAGGTATCTTAAGCATGAGAGCCATTTTTTATCATACCA
TTGACGAGATATACTAGAGAAGAGGCAAGCTTTGTGGAAAGATTTGGTTAAATGTAAATATGGGGAGGATGGATTTTGGTGTAATGACATACTCACGGAT
GCTTATGGAATGGGGTTTAAAGAGCTATTATACACTTCTGGCCCTACTTACATACTCATTAACAGTGTCGCGGTGGGGATGGCTGGACAACAATCTTCTG
GAGGGAGGTTTGGATCAAACTACCCCCCCCCTGAATACCCTGTCTCCGTGTCTTCCTTTTGTTTGATTGCCGGGAAGCACCCCGTTGATATATTTTTTTT
TCGATGAAATCTAAGTGGTTTGGAATTTGCCACATAATTCCCTTTTTTTGTTTAAAGGGGTAGATTTTGTCCACACTTTTTACCGTACATTATGTTTGTT
GATCGTTTACCTATCTCCGGTGGATTCTCTATTATATGTAAGGGTTTATAAAGTGTGGCCCCTCTCATAG
>LE_HBa0179A02_SP6_125176 (trimmed for quality and cloning vector)
TTTTGGGTTGCGGAGTGGGAAATTGCCCCCTACTTATTCGGGTATTATGAAATACATACAAAGATTTGAAGATATGGGACAACATATTTGAGAGGGGAGA
AAAGAGACTAGCTAGATGGAAGGCTCAGTACATTTCTTTTGGTGGCA

This is probably not a useful sequence.

Problems:
  • Short cloning insert
Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.92072
Expected error %
1.7294
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0179A02
Clone
Clone name
hba-179a2
LE_HBa0179A02
P179A02
Clone type
BAC
Contamination
none
Estimated length
156,649
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found