Clone Read LE_HBa0179M04_SP6_125466

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0179M04_SP6_125466
Primer
SP6
ID from Seq. Facility
LE_HBa_179_M04-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
515 trimmed for vector and quality, 1010 raw
Genbank Accession
Sequence
>LE_HBa0179M04_SP6_125466 (raw untrimmed)
TCCCCGCTTTTCCTAATGAGAAGTAACGTGCATGTTAGGCCCCAGTATCAACATCCATTCAGGGGAAGGGCCGGCTCCCATATGCATAATTGGCACGGTT
ATCACTATTTCGGTTCTCTTCTTACCGAAACAAGCAACGAACAGCGGTGTGTCCTATTTTCTGACAAATTTGACAAGTTGAATGATCCCGCTCGTAAGTG
CCCTGCCCGCCGCTGGAAGATGACTGCCCGCCGCTGCCGAAGGAGTGCAGGCTGTTGTTGTTGCCGTGCTGCTGACCGTCGTACGGCGGACGACTGCTCT
GCCGACCGCCGCGCCCGCGGCCTCCGCTGTTTCTGCCGTAGCCGCCGCGGCTCCCCTGCCGGCCGCCACCACGCCCCCCGCGATAGTTCTAGCTTGCAGT
GAGGGCAATGGCCGGCTCCATAACAGTGGCTTCTCGAAGAAGAAGTTTGCTCTCCAGATCCACATTGATTTCTTCACTTTTTAGCCACGAAGAGAGAGTA
GCCAAGTCAACGGGCGTTGGACTGATGCGAACCGCCTGTTTAATGGAGGAGTAAGCTGATGGGAGCCCCCGAACGACGCACATGACGAGATCTTTTTTCC
GGAATGATTTCGTTCACGGTGTCGAGGGCTGTGATGATGGTGGAGACCTCCTTCTAAATACTTCCGCCATAGTTTTCGTGCCTTTGGTAATTGTGTGGAT
ACCAATTCCCCAATTGAAAAAAAATGGGGAAATTGATGCATAATCGTGTTTGCCAGGGCCGTCCCCCAAGGGTCTAAAGCTTTTGTGTTTGGAATCTAAC
CGTTTTTCCTTAACCCTGGTGAAAAAATTACCCTTCAATTAAACTTTGTTTTCGGATTTTGGCCTTTCCCCCTGTTTTCTTCTCCCGTGCTTGGGTCCCA
AATTTTGTTTTTTTTTGATTTTGTTTCTGTTGTGTGGTGTTTTCTATGCCCCTCCTTCTCTTCTTTTTTTCTTTCCCCTTTACTCATTTTTTGTGGAGAC
GGCTATATTC
>LE_HBa0179M04_SP6_125466 (trimmed for quality and cloning vector)
AACATCCATTCAGGGGAAGGGCCGGCTCCCATATGCATAATTGGCACGGTTATCACTATTTCGGTTCTCTTCTTACCGAAACAAGCAACGAACAGCGGTG
TGTCCTATTTTCTGACAAATTTGACAAGTTGAATGATCCCGCTCGTAAGTGCCCTGCCCGCCGCTGGAAGATGACTGCCCGCCGCTGCCGAAGGAGTGCA
GGCTGTTGTTGTTGCCGTGCTGCTGACCGTCGTACGGCGGACGACTGCTCTGCCGACCGCCGCGCCCGCGGCCTCCGCTGTTTCTGCCGTAGCCGCCGCG
GCTCCCCTGCCGGCCGCCACCACGCCCCCCGCGATAGTTCTAGCTTGCAGTGAGGGCAATGGCCGGCTCCATAACAGTGGCTTCTCGAAGAAGAAGTTTG
CTCTCCAGATCCACATTGATTTCTTCACTTTTTAGCCACGAAGAGAGAGTAGCCAAGTCAACGGGCGTTGGACTGATGCGAACCGCCTGTTTAATGGAGG
AGTAAGCTGATGGGA

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.981671
Expected error %
0.3077
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0179M04
Clone
Clone name
hba-179m4
LE_HBa0179M04
P179M04
Clone type
BAC
Contamination
none
Estimated length
100,932
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found