Clone Read LE_HBa0183A08_T7_125566

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0183A08_T7_125566
Primer
T7
ID from Seq. Facility
LE_HBa_183_A08-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
609 trimmed for vector and quality, 814 raw
Sequence
>LE_HBa0183A08_T7_125566 (raw untrimmed)
CTGGTACCCGGGGGATTCTCTAGAGTCGACCTGCAGGCATGCAAGCTTTTTGAATACAAGAGATTTGACCCTTGGGTTGTTCCCAATGAAACATTCGAAT
GTTCATCTCCCTTGTTCTGCAAATTTTTTACTTCTAGTAGTATGTATAATAAGAATCTCGAGCATGTTCTTGGTATGTGGTTCTAACTGATCATTATGTA
TAGACTTCATGATTTGATAATGTTGAATGAGACGTATAGGAAAGCTTCGTATAATCAAAGCCCAATTGTGTTCGAGAAGAAGAAATTATTATAAGTCATT
TATGAAATTCCATTTACTGTTGAAAGGGATGAAGATTTCGATTAGTAATTGTGTTTTACAGCAGATGTGTTTGTAATTATTTGGAATGCAATATTTCCAA
GAAGAAATAACAGTGAAAATCAAAACTAGTTAATTAATCTTCATTACAAAATTAACTTATTAGTTTAGCCAAACTAAGCACTAAATTGTTCTTATGATCT
TATCAAAACAAATGTTAAAAGTTGTCTTGTTTGAAATGATGAGATCATTATAGTATATAAATAAAGTTATTTTGAGAAAGCTTCCATGTATCATTATTAT
TGTTTAGTTGAAGATTGGTTTCTGCTTATAAATTTGACCCACAATATTATTCCTAAAAAGTTTATAGAAAATTGGCAAAAGACTAATATATACCAAAATT
AACATGACCAATGTACTCTCACTTTTTCCCTAACCCTTGGGTATTTCCATCCATTGGGACTAGTCCCCAATCTTCACTTTTCCTATTGAATTTTGAATTT
TTGATTTACTTTGA
>LE_HBa0183A08_T7_125566 (trimmed for quality and cloning vector)
AGCTTTTTGAATACAAGAGATTTGACCCTTGGGTTGTTCCCAATGAAACATTCGAATGTTCATCTCCCTTGTTCTGCAAATTTTTTACTTCTAGTAGTAT
GTATAATAAGAATCTCGAGCATGTTCTTGGTATGTGGTTCTAACTGATCATTATGTATAGACTTCATGATTTGATAATGTTGAATGAGACGTATAGGAAA
GCTTCGTATAATCAAAGCCCAATTGTGTTCGAGAAGAAGAAATTATTATAAGTCATTTATGAAATTCCATTTACTGTTGAAAGGGATGAAGATTTCGATT
AGTAATTGTGTTTTACAGCAGATGTGTTTGTAATTATTTGGAATGCAATATTTCCAAGAAGAAATAACAGTGAAAATCAAAACTAGTTAATTAATCTTCA
TTACAAAATTAACTTATTAGTTTAGCCAAACTAAGCACTAAATTGTTCTTATGATCTTATCAAAACAAATGTTAAAAGTTGTCTTGTTTGAAATGATGAG
ATCATTATAGTATATAAATAAAGTTATTTTGAGAAAGCTTCCATGTATCATTATTATTGTTTAGTTGAAGATTGGTTTCTGCTTATAAATTTGACCCACA
ATATTATTC

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.912082
Expected error %
0.5435
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0183A08
Clone
Clone name
hba-183a8
LE_HBa0183A08
C02HBa0183A08
P183A08
Clone type
BAC
Contamination
none
Estimated length
80,515
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found