Clone Read LE_HBa0183I10_T7_125760

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0183I10_T7_125760
Primer
T7
ID from Seq. Facility
LE_HBa_183_I10-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
318 trimmed for vector and quality, 937 raw
Sequence
>LE_HBa0183I10_T7_125760 (raw untrimmed)
GGGGTCCCGGGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTGATTGTGTCATACCTTGCTACAGGTGCAAATGTTTCCTGGTAATCCACACCA
TATTGTTGTGCGTATCCCTTCACCACCAATCTAGCCTTATATTTGCAAATTGTTCCATCAGGATTGAGTTTTGTCTTGAAAATCCATTTTACACCAATTA
CCTTGCTGATTTCTAGTTCTGTCAACAAATTGCAAGGCTCCATTCTTCTCGATCATGTCTAGTTCTTCTTGCATAGCTCTCCTCCATGCCTGAGAGTCCT
GTGCTTCAGCATAGCTTGTTGGTTCATAGCTAACCAATTTACACCTCTCATATACATCTTTTTAGGATCTAGTTCCCCCCACGGGTACATCAACCACTAT
TTCATCCTCTTCACCTCCAGGCTTCTCTAAAATATCTTAATTAGAATTATAGGTTATTATGATTTTTATTTTTTTATTTTTTTTGTTTTTTCAACTTTGT
TTTTATTTTTTCACAGACTTAGTTCTTCATCTTCTGTTATATGTACCTCATTTTTCTTTTTTTATACATTATCTCATCTATATAAATCACTATTTCGTAA
TCTTTGTTTTTTCCATTCTCCTTTATCTTGTTTTTACCGTTTCTCTCAACTTTTTTCACTCTTCCCGTATTCATCTTCGCATGTAGTGTATTACACACCA
TCTGTCATCTCTTCCGTTCTGTCCCTTCTATCTTGTGCCTTTCTATTTCTCTGTGTTATCTTTTCTAGCTTTGTGCAGTTCTCGTGTCTTTAGGTCCCTT
TCTCAAGTTTCCTCCTCATTCGTCCCATTGCTTCTACTACTTTCTTCTTTTGTCTCTTTCCTCACCAATCTACTTTACTTCTTTACTCTCTTATTTCCAC
ACTCCCTCTATACTCTCAAGTCTTTATTCCACCCACC
>LE_HBa0183I10_T7_125760 (trimmed for quality and cloning vector)
AGCTTGATTGTGTCATACCTTGCTACAGGTGCAAATGTTTCCTGGTAATCCACACCATATTGTTGTGCGTATCCCTTCACCACCAATCTAGCCTTATATT
TGCAAATTGTTCCATCAGGATTGAGTTTTGTCTTGAAAATCCATTTTACACCAATTACCTTGCTGATTTCTAGTTCTGTCAACAAATTGCAAGGCTCCAT
TCTTCTCGATCATGTCTAGTTCTTCTTGCATAGCTCTCCTCCATGCCTGAGAGTCCTGTGCTTCAGCATAGCTTGTTGGTTCATAGCTAACCAATTTACA
CCTCTCATATACATCTTT

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.940467
Expected error %
1.5696
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At4g23160.1 Score 71 E Value 9e-14 Identity 19.50% Align. Length 158bp (49.69%) Frame 1
68417.m03342 protein kinase family protein contains Pfam domain PF00069: Protein kinase domain
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAP51797.1| Score 86 E Value 1e-23 Identity 69.80% Align. Length 306bp (96.23%) Frame 1
putative copia-type polyprotein [Oryza sativa (japonica cultivar-group)] ref|NP_919510.1| putative copia-type polyprotein [Oryza sativa (japonica cultivar-group)] gb|AAL75752.1| Putative copia-type polyprotein [Oryza sativa]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAP46257.1| Score 84 E Value 3e-23 Identity 67.90% Align. Length 306bp (96.23%) Frame 1
putative polyprotein [Oryza sativa (japonica cultivar-group)] ref|XP_470160.1| putative polyprotein [Oryza sativa (japonica cultivar-group)]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0183I10
Clone
Clone name
hba-183i10
LE_HBa0183I10
C03HBa0183I10
P183I10
Clone type
BAC
Contamination
none
Estimated length
35,127
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found