Clone Read LE_HBa0183J02_T7_125776

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0183J02_T7_125776
Primer
T7
ID from Seq. Facility
LE_HBa_183_J02-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
315 trimmed for vector and quality, 819 raw
Sequence
>LE_HBa0183J02_T7_125776 (raw untrimmed)
TAGTCACTCTATAAGTAAGTTATTGTGCCGCACGGGGGTATCTCTTAGTCTACCTGTAGGCATGCAAGCTTCATTAGTATTACCATTATCACACTTATTA
TAGGTATAGCAAGAGGAGGAAGTCAAAAATATAGTTATTGATACAAGTGTCACATTCACCAGCTACAAGATCAAGTGGTTAAAAATATGACACACTCAAT
TTTAAGTTGAGCTCGGAGTTTGGTCAATAGTAACTATATGAAGATCTCAACTGAAAAATTATTCCGGAGTGAATCTGTCTGAGGCATAGATTACTCCTCT
ACTTATGATTCACCCACTAGAAATGATTAAAGGAGACGGAGAAGCAAGGACAATCATCAATACTAAATATTATCAAGGAAACATGAACAGAGCAATTATT
ATCTTAATGGACAATGAGTTCTAGTAAGCAGGCGTGCTATTTAAAAAGCTAATCAAATGTCACAATGTCGTTATATTGACTAGCACAAGATTTAAGGACT
ACGATCAATAGTTAAGATCTTTCTTGATCATATGAATCTTCTATCAAAATTGTAAAATAACAGTAACAACTATTCCATTTTTGGGAGTAAAACAAACTTA
CGTCATATATTCACAAACCTCCTGTATTTAACCTCAAAACAATACTCCCTCGAAAACCAGAACCCAACCCAAAAGCCACGTTCCAGTCCTCAGATACTGC
CCTTCTTGGAAATTAGCTATTCCACGATCCAATTGTAATCTTAGCTTTACACGTCTGATCGATCGGCGTACAACTAAGATTCATGAGAGTCTAGGTAATT
AGCCATGTAAATTATGGAT
>LE_HBa0183J02_T7_125776 (trimmed for quality and cloning vector)
TTATAGGTATAGCAAGAGGAGGAAGTCAAAAATATAGTTATTGATACAAGTGTCACATTCACCAGCTACAAGATCAAGTGGTTAAAAATATGACACACTC
AATTTTAAGTTGAGCTCGGAGTTTGGTCAATAGTAACTATATGAAGATCTCAACTGAAAAATTATTCCGGAGTGAATCTGTCTGAGGCATAGATTACTCC
TCTACTTATGATTCACCCACTAGAAATGATTAAAGGAGACGGAGAAGCAAGGACAATCATCAATACTAAATATTATCAAGGAAACATGAACAGAGCAATT
ATTATCTTAATGGAC

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.940536
Expected error %
0.4618
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0183J02
Clone
Clone name
hba-183j2
LE_HBa0183J02
P183J02
Clone type
BAC
Contamination
none
Estimated length
87,910
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found