Clone Read LE_HBa0187G12_T7_126481

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0187G12_T7_126481
Primer
T7
ID from Seq. Facility
LE_HBa_187_G12-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
438 trimmed for vector and quality, 965 raw
Sequence
>LE_HBa0187G12_T7_126481 (raw untrimmed)
AATATATTATTATACTGTAATTTTAGTGAGTCGGCCGAGGGTCCTCTAGAGTCGACCTAGCAGGCATNGCAAGCTTTAATTCTTATTTATAATTTAAACA
AACATTTTAAAATTATGCATTATATATATTAAAAGATTGTTATTGATGAACTTGCCGAGAGTCTTTCAAAAATCATCTCTCTACCTCCATGAGGTAGTGG
TACGGTATGCATACACTCTACCCTCCCCAAACCCACTCACTGGGATTCCACTGGGTAAGTTGTGGTATATTAAAAGATTGTTAGAGTTACATACAAATTT
TACAACAATCGCTAGGCTACACGGGTGAGGCACTTAAACACTATATTAAAAACACAAAATCTCTAAATGAATTGTTGTTCGCCTTTTTTACCCCTTGCAA
ATAGGGTTCACAATGAATGAATTTGTAACTGAATTATTTTTCAAATTCTTGGGACTTTGAAGTTGAACTAAAAAATTCCTATTAATAATCTTTCTTCATT
GATCTATATACAAAGTCCTACTATTTAGGATTTATAACCAATACAGATTTTACCTTATATCAACTCTTATTCTATTTGAACGTTTCACAAGGTGAAATAA
CCTTTATCACTATTATTGTATTCAATTTTTTATTACTGACTCTCGTTTTCATAGCACTCCGGAGAATTAATTTTCTATAACTTAGTAACGAGCTTAGAGG
TTAATCATCATAGTTCACATAACTCACATATTATCCTCTTTGGAGATGTTGCGATGTTAACAATATGGCTTTGTTCTATCTCTGATCTTTTATTTGTATA
TTATTGTATTGGCTGGAGTAGGAAGTGCTGCTGGATCATAACAGGGTTTGATGCTTATCAGATTTTGAGACGATAGAATATGATGATTAAAACGATCCTA
TAGATATCTATTATAAGCTAAAAGAATAACTTGCAGAACTATTGTAAATGAAGATATTCCAATCG
>LE_HBa0187G12_T7_126481 (trimmed for quality and cloning vector)
AAGCTTTAATTCTTATTTATAATTTAAACAAACATTTTAAAATTATGCATTATATATATTAAAAGATTGTTATTGATGAACTTGCCGAGAGTCTTTCAAA
AATCATCTCTCTACCTCCATGAGGTAGTGGTACGGTATGCATACACTCTACCCTCCCCAAACCCACTCACTGGGATTCCACTGGGTAAGTTGTGGTATAT
TAAAAGATTGTTAGAGTTACATACAAATTTTACAACAATCGCTAGGCTACACGGGTGAGGCACTTAAACACTATATTAAAAACACAAAATCTCTAAATGA
ATTGTTGTTCGCCTTTTTTACCCCTTGCAAATAGGGTTCACAATGAATGAATTTGTAACTGAATTATTTTTCAAATTCTTGGGACTTTGAAGTTGAACTA
AAAAATTCCTATTAATAATCTTTCTTCATTGATCTATA

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.932781
Expected error %
0.1624
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0187G12
Clone
Clone name
hba-187g12
LE_HBa0187G12
C03HBa0187G12
P187G12
Clone type
BAC
Contamination
none
Estimated length
149,038
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found