Clone Read LE_HBa0195O08_SP6_127053

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0195O08_SP6_127053
Primer
SP6
ID from Seq. Facility
LE_HBa_195_O08-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
439 trimmed for vector and quality, 936 raw
Sequence
>LE_HBa0195O08_SP6_127053 (raw untrimmed)
CCCGGCTTTTTGGTTCTTTCTTCTCATCAAACGGTGCTATTCGATAATGTCTGTCTAGCAGACTCCCTGCTAAGCTTTAAAGAGCTTCAAATATAAGGGA
GAAAGAAAAACGAGTCCTTAAAGGGAATG
GGTTAAAGACCANAGCAACGGATCTTCCATCNTGCAAATAAGGCATATCTATGTCTAGGCATCATTTAAGG
AAATGATACCTTTATTTCCGTGTCTTCCAGCTACTTTATCGCCTACTTTGATTTCACGTTTCTGTGAAATATATACACGAATCGTTTCGGGATTATAACT
AGAACCACCCCTTTTCTGGATCCACCTCACATCAATAATCCGACCCCTGCCACCTATAGGTAATTTTAGACAAGTTTCTTTTGAAGTAGATACCTGAATA
CCAAGTATATTTTTTTTTAATCTATCTTCCTTGGGCATACGAAGATTCTTTCACAACTTGGGGTGTTTATTTTTCTACTACAATATCACCCGTCTCTACC
CAAGATCTCCAGCATAACAGTTCCTTTTTTGTCTAAATTGCGGAGTAAATGGGCTTCTAAATGTGGTATTTCATTAGTTACTTTTTCAGGGCCTTGACTA
GTCACATGAGTATGAATTTTCACATTTCCGTATGTGAAAAGAAGAATAAATATCTTCATATACCATACGCCTCGTCTATAAGTACTGGATTTCATGAATT
GAACCCTTCCACGGCATATTACCTACAATACGTTTTTCCCCCAAATAAGTTTCTTCTCATACGTTTCACTACCCTCTGTTATAATTTGTCTTTTTTTAAT
TGATTTTCCCCCATGTATTTTTATTTTTTGATGATATCACATTTTTTTTGGCAACGTGAATTAGAAGTATTGGATGTTATAATTTTTCTATACTGGGGTA
AAAACTTATTATTTTTTTTTTTTTTTTTTTCTTTTT
>LE_HBa0195O08_SP6_127053 (trimmed for quality and cloning vector)
GGTTAAAGACCANAGCAACGGATCTTCCATCNTGCAAATAAGGCATATCTATGTCTAGGCATCATTTAAGGAAATGATACCTTTATTTCCGTGTCTTCCA
GCTACTTTATCGCCTACTTTGATTTCACGTTTCTGTGAAATATATACACGAATCGTTTCGGGATTATAACTAGAACCACCCCTTTTCTGGATCCACCTCA
CATCAATAATCCGACCCCTGCCACCTATAGGTAATTTTAGACAAGTTTCTTTTGAAGTAGATACCTGAATACCAAGTATATTTTTTTTTAATCTATCTTC
CTTGGGCATACGAAGATTCTTTCACAACTTGGGGTGTTTATTTTTCTACTACAATATCACCCGTCTCTACCCAAGATCTCCAGCATAACAGTTCCTTTTT
TGTCTAAATTGCGGAGTAAATGGGCTTCTAAATGTGGTA

This is probably not a useful sequence.

Problems:
  • Probable foreign DNA contamination
Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.977395
Expected error %
2.697
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
emb|CAC88036.1| Score 149 E Value 2e-50 Identity 94.80% Align. Length 435bp (99.09%) Frame 3
RNA polymerase beta subunit [Atropa belladonna] ref|NP_783224.1| RNA polymerase beta chain [Atropa belladonna] sp|Q8S8X9|RPOB_ATRBE DNA-directed RNA polymerase beta chain (PEP) (Plastid-encoded RNA polymerase beta subunit) (RNA polymerase beta subunit)
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
emb|CAA77346.1| Score 147 E Value 7e-50 Identity 93.50% Align. Length 435bp (99.09%) Frame 3
RNA polymerase beta subunit [Nicotiana tabacum] emb|CAA31238.1| unnamed protein product [Nicotiana tabacum] ref|NP_054488.1| RNA polymerase beta chain [Nicotiana tabacum] pir||RNNTB DNA-directed RNA polymerase (EC 2.7.7.6) beta chain - common tobacco chloroplast sp|P06271|RPOB_TOBAC DNA-directed RNA polymerase beta chain (PEP) (Plastid-encoded RNA polymerase beta subunit) (RNA polymerase beta subunit)
Nicotiana tabacum Chloroplast (screening/organelle/nicotiana_tabacum_chloroplast)NCBI BLAST
gi|11465934|ref|NC_001879.1| Score 559 E Value 1e-161 Identity 91.30% Align. Length 438bp (99.77%) Frame 2
Nicotiana tabacum plastid, complete genome
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0195O08
Clone
Clone name
hba-195o8
LE_HBa0195O08
P195O08
Clone type
BAC
Contamination
none
Estimated length
85,999
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found