Clone Read LE_HBa0001B24_T7_127182

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0001B24_T7_127182
Primer
T7
ID from Seq. Facility
Le-HBa001_B24-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
504 trimmed for vector and quality, 1206 raw
Sequence
>LE_HBa0001B24_T7_127182 (raw untrimmed)
AGGCCGGGTCCCGGGGGAATCTCTAGAGTCGACCTGCAGGCATGCAAGCTTCAACCATGGCTCCCCTTTCTTCCCCTTTAAGGGGAACNAGCTGCTGACN
CAACCNCAANCCNCCTCCTTAAGGGGCGGAAAGGGNAGNAAGAAGGGGGGNNCGGGNGCGCNNCNNNCNCCNGCCGGNNCAGGAGCNNAGGCCCAAGCGG
NAGNAGNNNCCNAGNNGGAGNNGGCACACGCCNCGCNNNCCANCANNNGNGGGNCNGGACCCNANNNNNNNNNCAANNNCGAGAAGAANGAGAAANNNNN
CNCGCAGACAACGGNGNANNGNCNAANCNANGAGAANCAAGCNNNNCCCCNNCCGNAAGCGCANANAGGGAAGNGGGCCCNCGGCNANNGAGAGAAGNNN
CAAAGAGCNCCACACNNNCAGAACNGAANAACCAACAAANAANCNGAACAACCAACAACACNACNACACNCACANCANNGNGAANANNNGAGAANGNGAN
GAAAAANAAAAAGNNGCNAAGAAAANCAAAGAANGAAGAAGAAGAAGAGAGNAACGGGCGGGGACAGAAGAACCCGACCCCGCAAACCCNANACCAAAGG
GAAAGGGAAGGGGGAGGGAAGAACAGGGACCCCCACGCAAGCAAGCGCCGCCAACACGCAGGAGNCAGAAGAAGGGCAAAGGAACACAACGACAGCAAGA
AACGCAACGAAACACGGGAGAGCAAAACAAAGGGGAGGAGGCGGCAGCGAGGACGAAGAGAACACCAAGCGCCGCCACACACGCGAGAGACCACCACACG
CCCCCACCAGCCACCACAACCCCAACGCACACGCAGACCGGCCCGCGACCCCCCGCACCCCGGGCCACAGGAGCAACCCCACCCAGAACACACAAAACCG
CCAGGAACACAACCCCAGACGGCCCGCCACCACACAAAAAAACACACAAAGAAAACACAAAGAAAACGCAAGCAACGCCACACGCGGAAGAGCACAGAAC
CCAGAGCGCGGCCACGCAGCCCGGCAGCAACACGGCGCCAAACGCCCAAACAAACGCACGCAGCCCCCCAAACGCGACCACACGCCGACACCACAGAGCA
CAAGAGGACCACAAGGCCCCGGCCCACGGACGCAAGCGCCCGCGCAGAGAGGCCCCCGCCAGCCAACGAACAGCAGAGGCGGACGACGGGACAAGGAGCA
CCCGCA
>LE_HBa0001B24_T7_127182 (trimmed for quality and cloning vector)
AGCTTCAACCATGGCTCCCCTTTCTTCCCCTTTAAGGGGAACNAGCTGCTGACNCAACCNCAANCCNCCTCCTTAAGGGGCGGAAAGGGNAGNAAGAAGG
GGGGNNCGGGNGCGCNNCNNNCNCCNGCCGGNNCAGGAGCNNAGGCCCAAGCGGNAGNAGNNNCCNAGNNGGAGNNGGCACACGCCNCGCNNNCCANCAN
NNGNGGGNCNGGACCCNANNNNNNNNNCAANNNCGAGAAGAANGAGAAANNNNNCNCGCAGACAACGGNGNANNGNCNAANCNANGAGAANCAAGCNNNN
CCCCNNCCGNAAGCGCANANAGGGAAGNGGGCCCNCGGCNANNGAGAGAAGNNNCAAAGAGCNCCACACNNNCAGAACNGAANAACCAACAAANAANCNG
AACAACCAACAACACNACNACACNCACANCANNGNGAANANNNGAGAANGNGANGAAAAANAAAAAGNNGCNAAGAAAANCAAAGAANGAAGAAGAAGAA
GAGA

This is probably not a useful sequence.

Problems:
  • High predicted error rate
Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
1.02726
Expected error %
37.8529
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0001B24
Clone
Clone name
hba-1b24
LE_HBa0001B24
P001B24
Clone type
BAC
Contamination
none
Estimated length
125,531
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
3 sequencing reads found