Notice: If you try to use Google Chrome to access the SGN FTP site, please check this link to resolve connection issues.

Due to a hardware issue, SGN was briefly unavailable earlier today. We apologize for any inconvenience.

Clone Read LE_HBa0001C13_SP6_127205

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0001C13_SP6_127205
Primer
SP6
ID from Seq. Facility
Le-HBa001_C13-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
751 trimmed for vector and quality, 1205 raw
Genbank Accession
Sequence
>LE_HBa0001C13_SP6_127205 (raw untrimmed)
CCCCAATTTTGCATGTTCATGATCATTTCAAACTTGAAGATTTAATTCTAACTTGAAGATTTAAGTGACATACAGTTTCATCTCGTGTTTTATGGAGCAT
TTAAACTTAAAGATCTAACCGTGATACAGTTTAAGCTCTTGTTTCAAGGAGCATTGTAAATCTAAATGAGATACAGTTTAAGCTCTTGTTTCAAGGAGCA
TTTTAACTTGCAGTTTAAGCTCATGCATTAAGGAGCGTCAAGATATACATTGACTCTTTTCAAAGTCATCTTTGGATGCAGATTTGCCACCACTTTGGAG
TTCTTCTATATGTTCATCTTCGTGAGGTCCATAGACAGGATATTGTTGATCTTCGCATAAAGTCATGCTTAATTCCATGTCATGTGCATAAGTTGCCAAC
TCTTCAAATGTATTGGGCTTTAATCCTTGCAAAATGTAGTGAAGACCTCAATTCATACCTTGGATGCACATTTCAATGCTAGAAATTTCAATAAGGCGAT
CTTTGCAGTTGAGACTCAAACTTCTCCAACGATTGATAAAGTTAACAACTAACTCATCTTCACCTTGACGAGCCTTTGTATGCTTCATCATACTAACGAC
ACGTCTTGTGCTATAAAAACGATTAAGGAACTCTTGCTCTAATCGCTCCCAACTATCTATAGAATTAGGTTCAAGATCTATGTACCAATAAAATGCATTT
TCTCTGAGAGATCGAACGAACTCTTTAACAAGATAATCGCCATACGTCCCAACATCATTGCAAGTCTTGATAAAGTGTGCTATACATTGTTTGGGATTTC
CTTTGCCATCAAATTGTTGAAACTTTGGAGGTTGATAACCCTCAAACATTTTCAAGTTTTCAACCCTATGTGTATATGGGCTTTCCATATATGGGAAAAA
ATTTGAATAAAAACTCAAATTTGTCTTCGATGGTCTCTTTATTAAGTTTCTTTAATGATAAATTGGAATCAAACCTTTCGCCTGGGAAATGAAATTCTTT
TATTCTTTTTTGTTTTTAACCAAGACACTTTTTTTTTTTTAAATTTTAAAAACCTTCGGAGGGGATTGATTTAATTTTTTTTTCAACCATTTTTTCCATT
TTTTTTTGTTGCTTTTGAAAATTTTACCTCTTTTTCCGTTTCCCCCCTTTTTCGAGGGCCTTAATTTGTTTTTTTTTAAACCTTGCCTAATTTGCCTCTT
TTAAN
>LE_HBa0001C13_SP6_127205 (trimmed for quality and cloning vector)
TTGAAGATTTAATTCTAACTTGAAGATTTAAGTGACATACAGTTTCATCTCGTGTTTTATGGAGCATTTAAACTTAAAGATCTAACCGTGATACAGTTTA
AGCTCTTGTTTCAAGGAGCATTGTAAATCTAAATGAGATACAGTTTAAGCTCTTGTTTCAAGGAGCATTTTAACTTGCAGTTTAAGCTCATGCATTAAGG
AGCGTCAAGATATACATTGACTCTTTTCAAAGTCATCTTTGGATGCAGATTTGCCACCACTTTGGAGTTCTTCTATATGTTCATCTTCGTGAGGTCCATA
GACAGGATATTGTTGATCTTCGCATAAAGTCATGCTTAATTCCATGTCATGTGCATAAGTTGCCAACTCTTCAAATGTATTGGGCTTTAATCCTTGCAAA
ATGTAGTGAAGACCTCAATTCATACCTTGGATGCACATTTCAATGCTAGAAATTTCAATAAGGCGATCTTTGCAGTTGAGACTCAAACTTCTCCAACGAT
TGATAAAGTTAACAACTAACTCATCTTCACCTTGACGAGCCTTTGTATGCTTCATCATACTAACGACACGTCTTGTGCTATAAAAACGATTAAGGAACTC
TTGCTCTAATCGCTCCCAACTATCTATAGAATTAGGTTCAAGATCTATGTACCAATAAAATGCATTTTCTCTGAGAGATCGAACGAACTCTTTAACAAGA
TAATCGCCATACGTCCCAACATCATTGCAAGTCTTGATAAAGTGTGCTATA

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.964159
Expected error %
0.5401
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0001C13
Clone
Clone name
hba-1c13
LE_HBa0001C13
P001C13
Clone type
BAC
Contamination
none
Estimated length
108,372
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
3 sequencing reads found