Clone Read LE_HBa0013I23_SP6_128289

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0013I23_SP6_128289
Primer
SP6
ID from Seq. Facility
LE_HBa_013_I23-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
622 trimmed for vector and quality, 855 raw
Genbank Accession
Sequence
>LE_HBa0013I23_SP6_128289 (raw untrimmed)
CCCCCCCTTTTGGACCANGTNGGGAAGGCAAGAAATTCATCCCTTTATTGTGATGCATCTTATTCTGGGTTGGATGCAGTGCTCCTTCAAGAGAGAAATG
TGATTGCTTATGCTTCTAGGCAATTAAAAGTGCATGAACGTAAATATCCGACCCATGATTTAGAGTTGGCCGCAGTCATGTTTGCATTAAAGCAATGGAG
ACATTATCTATATGGGGTTAAGTGTGAAGTCTATACAGATCATCGTAGTTTACACGTATGTCTTTACTCAGAAAGATTTGAATTTGAGACAGAGGAGATG
GATGGAACTACTAAAGGACTATGATGTTACTATATTGTATCACCCAGGAAAAGCTAATATGGTGGCAGATGCTTTAAGTAGAAAAACAGGGAGCATGGGA
AATCTAGCCCACTTACAAGTTTCGAGACGCCCATTGGCTAGAGAGATTCAGACTCTTACTAATGACTTTATGAGGTTGGAAGTACTAGAGAAAGGAGGAT
TTTTGGCCTGTGTTGAGGCAAGATCTTCTTTTCTTGACAAGATCAAGGGAAAATAGTTTGATGATGAGAAGCTGAGCCAAATTCGGGATATGGTGTTGCG
AGGAGAGGCTAAAAAGGCAATAATGGATGAGGAGGGCATTTTTGAGAATTAATGGAAGGGTATGTCTGCCCCGTGTTGATGATTTGATCCACATTATTCT
TTCAGAGGCTTATAGTTCAGGATATTCTAATACATCCTGGTGCCACCAAAAATGTATCGCGACCCTAAGGCAACATTTTTGGGGGAAGTAAGATGAAAGC
TTGACATTTCCTAATTTTTGTTGCCCCAATTGCTCCAAATTTGTCAAAAAGTTAA
>LE_HBa0013I23_SP6_128289 (trimmed for quality and cloning vector)
AAGGCAAGAAATTCATCCCTTTATTGTGATGCATCTTATTCTGGGTTGGATGCAGTGCTCCTTCAAGAGAGAAATGTGATTGCTTATGCTTCTAGGCAAT
TAAAAGTGCATGAACGTAAATATCCGACCCATGATTTAGAGTTGGCCGCAGTCATGTTTGCATTAAAGCAATGGAGACATTATCTATATGGGGTTAAGTG
TGAAGTCTATACAGATCATCGTAGTTTACACGTATGTCTTTACTCAGAAAGATTTGAATTTGAGACAGAGGAGATGGATGGAACTACTAAAGGACTATGA
TGTTACTATATTGTATCACCCAGGAAAAGCTAATATGGTGGCAGATGCTTTAAGTAGAAAAACAGGGAGCATGGGAAATCTAGCCCACTTACAAGTTTCG
AGACGCCCATTGGCTAGAGAGATTCAGACTCTTACTAATGACTTTATGAGGTTGGAAGTACTAGAGAAAGGAGGATTTTTGGCCTGTGTTGAGGCAAGAT
CTTCTTTTCTTGACAAGATCAAGGGAAAATAGTTTGATGATGAGAAGCTGAGCCAAATTCGGGATATGGTGTTGCGAGGAGAGGCTAAAAAGGCAATAAT
GGATGAGGAGGGCATTTTTGAG

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.96117
Expected error %
0.2426
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT66771.1| Score 142 E Value 3e-62 Identity 53.10% Align. Length 606bp (97.43%) Frame 2
putative polyprotein [Solanum demissum]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT38745.1| Score 140 E Value 3e-62 Identity 54.70% Align. Length 600bp (96.46%) Frame 2
putative polyprotein, 3'-partial [Solanum demissum]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0013I23
Clone
Clone name
hba-13i23
LE_HBa0013I23
P013I23
Clone type
BAC
Contamination
none
Estimated length
106,320
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found