Clone Read LE_HBa0167D12_SP6_12838

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0167D12_SP6_12838
Primer
SP6
ID from Seq. Facility
LE_HBa_167_D12-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
352 trimmed for vector and quality, 875 raw
Genbank Accession
Sequence
>LE_HBa0167D12_SP6_12838 (raw untrimmed)
TATTAAAACAAATTTTTGGCGTTTCTTCTAAAAGAGCCCCTAGACTTTGTGTATTGTATATCAATCAAGGTCACCCCCTTTGGGGAGTGTCTTACATATG
CTGAGTATGCTTGATCCCCATTTGATAGGAGATCGACTACAGGCTATTGTGTATTCGTTGGAGAGAACTCAGTTTCATGGAGAAGTAAGAATTAAAGTGT
TGTATCTGGACGTATGCAGAATCTTATTACAGAGCTATGTCACAGTCTACTTATGAGATTATGTGGATACATTATGTTGTAATAGAAATTGGCATAAAGT
ATCCCTACCAACTATCTCTACTGTGATAATCAAGTTGCTCTTCATATTGTCTTAAATCCGATGTATCATGAAAGAACTACACATATTGAGGTTGATTGTC
ATTTTATTTGTGAGAAGATAAAGGATAATTTGATTTCAATTAGTTACATGAAGACATGAGAGCAACTAGCTTGTTTGTTCACAAAAGCATTAAATGGAAC
TTGAGTTGATTTCTTGTGTTACAAGCTGGGGCACGATCAATATATATGCTCCGGCTTGAGGGTGGAGCTTATCAATATTCATATTATAATTACTTTATAT
TTGTATATTGCGTCACACTTATTTTAATTTTATTAATATACATACGCTACTTTCTATCTTTTCAGTTAAATCTTTTTGTTCTTATTTCTAATTTCACTAT
TGTCATCATTGTACTAGTTAAATTTTTTTTATATTCTTAATTTAACACTTATTTTCTTATAAACACTATTTTTTACTCAAATATTATTTAATGTATAAGA
TATGTTAATAAAGTTATTGTTATAGCTACTAACGGCTAAATCGCGTCTTGAGTATCCAAATTTTTAGTCATTCTC
>LE_HBa0167D12_SP6_12838 (trimmed for quality and cloning vector)
GTGTCTTACATATGCTGAGTATGCTTGATCCCCATTTGATAGGAGATCGACTACAGGCTATTGTGTATTCGTTGGAGAGAACTCAGTTTCATGGAGAAGT
AAGAATTAAAGTGTTGTATCTGGACGTATGCAGAATCTTATTACAGAGCTATGTCACAGTCTACTTATGAGATTATGTGGATACATTATGTTGTAATAGA
AATTGGCATAAAGTATCCCTACCAACTATCTCTACTGTGATAATCAAGTTGCTCTTCATATTGTCTTAAATCCGATGTATCATGAAAGAACTACACATAT
TGAGGTTGATTGTCATTTTATTTGTGAGAAGATAAAGGATAATTTGATTTCA

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.943072
Expected error %
0.463112
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At4g23160.1 Score 71 E Value 9e-14 Identity 14.10% Align. Length 290bp (82.39%) Frame 3
68417.m03342 protein kinase family protein contains Pfam domain PF00069: Protein kinase domain
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAO26690.1| Score 109 E Value 2e-23 Identity 17.70% Align. Length 350bp (99.43%) Frame 3
gag-pol polyprotein [Vitis vinifera]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAO26684.1| Score 109 E Value 2e-23 Identity 17.90% Align. Length 350bp (99.43%) Frame 3
gag-pol polyprotein [Vitis vinifera]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0167D12
Clone
Clone name
hba-167d12
LE_HBa0167D12
P167D12
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found