Clone Read LE_HBa0167D12_T7_12839

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0167D12_T7_12839
Primer
T7
ID from Seq. Facility
LE_HBa_167_D12-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
201 trimmed for vector and quality, 815 raw
Genbank Accession
Sequence
>LE_HBa0167D12_T7_12839 (raw untrimmed)
TTCTCTATTGTACCACGAAATAAATGGGCATTTCGAGACTTGGAATTTTCTTTCAAATCCATTGTAATACTTTAAAGGTACGTAACATGCAATAATCAGG
TTTTGAGTTCTGGTTTTGAGTTAAATACGATTTCCGCATTATTCTTATGATGTTAGTCTCTTTTTCTTGTTTTACTTTTGTATTCATCGTATTAGTTGAG
TATTAGGCTGACTTGTCTTGATGAGATAAGACGAGTTTCCTTACGTCCATTTTTAGGTCGTGAGACTTCCTTTCATTAAACTCACAAAAACGATTGTCAT
CTCTTGGTCATGGCACACATAAACACAAACTGATATTCTATAAAGGCCATCACCGCTAGGGGAAAATGACCACTTTAAGTATGTCCTAACAAGAAAGAAT
CGGCATCATCTACTGCATAACTGTGAAAGAAAATATGATTTATTTTTCACAACGCATACAAAAAACTCTTTACATGATACATAAGAACACCGACCACCAG
TAAAACCAACTATATATATATAATAAATATATATCGATTGTTCTTCTTACTTTTTATCGCTTACCATGTTAAATCACATTAAATAAATATGATAGCGAAA
CACTAAGCTATTGTATTTAATACTGTCATTCTATTGTGAGATTATTGCCAGTGTTTTATTGAGTTTTTATTTCATAATGGGAAGCTTTCTTGTGTTATTT
CACACGCGAATACCAACATAACCAATAATGACTAACAATATAAATTTAAAGAAATAATCAATAAAATTAAATTAACCTCCAGCATTAATCCTGTCCATGT
CTAACTCTTTTTGCC
>LE_HBa0167D12_T7_12839 (trimmed for quality and cloning vector)
ATTTTCTTTCAAATCCATTGTAATACTTTAAAGGTACGTAACATGCAATAATCAGGTTTTGAGTTCTGGTTTTGAGTTAAATACGATTTCCGCATTATTC
TTATGATGTTAGTCTCTTTTTCTTGTTTTACTTTTGTATTCATCGTATTAGTTGAGTATTAGGCTGACTTGTCTTGATGAGATAAGACGAGTTTCCTTAC
G

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.908273
Expected error %
0.227645
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0167D12
Clone
Clone name
hba-167d12
LE_HBa0167D12
P167D12
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found