Clone Read LE_HBa0013M07_T7_128450

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0013M07_T7_128450
Primer
T7
ID from Seq. Facility
LE_HBa_013_M07-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
759 trimmed for vector and quality, 917 raw
Genbank Accession
Sequence
>LE_HBa0013M07_T7_128450 (raw untrimmed)
CCGGTCCCGGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTTAGTAAGACTCTAAGTCTGTGACACCATTTTGTTGATGTTATCTATGTGAAGA
ACAAATGGAGACAGCCTTCCATATCTTTTTGCATTTTAAATAGGCAAACCAACTGTGGCAGATGTTCTTACACAAGAGGAAGATCAGGTGGGTGAAACCT
GGGGGAATCAAAGAAGTGCTAAAAAGTTGAAAAAATTATAGAAATGTAGGAGAAAGGAAGAGATATAGAAGATGAATCCTACATATATCTCATTGACCAT
ATGGTAGGAAACAAATCAGAGACATTTTGAAGGCAAAAAGAGCAACATACAGAAGATCAAGACAGACTATTTATGCCTTTACTATTTTTGGTGTAAACAA
GTAGCTATAAACAACATTCAAAATGTACTTAATGCAATTGACCGGTTGTAATTAGAATAATTAGGATTTTGTAAAGAGAATTTTGTGATGGGGTACTATA
CTTTGTTGTAGTACACCTATGAATATATAGAAGTAAATTTTATCATTCTCAAAAAAAATAATTATGGATACTCTCTCAAACTATGAAGCAGTAAATGGAC
AAAACTACACAAAGATGAGTGTTTTTGTTTCTTTATCATAATGTGACTCCAGAGGTAAAACATAAGGTGTTTGAAATTACAAAAATTCCTAAAAAGCAGT
TCCCCTTTACATACTTGGGAGTACCAATTTGTCACGGGAAAAGACTGATTGTTCATCAAAAAGAGATCATAGACAAGATATTCAATAGACTCAATTCTTT
GAAAACAAAGTTGTTTTATATAGGTGGGGAGAGTAAACTCTCCATTAAAACATGTTTCTTCCAAAACCATGGATTCATACATCCTATTTAATTCTGCCTT
GTCCCAACCCCCTGGTA
>LE_HBa0013M07_T7_128450 (trimmed for quality and cloning vector)
AGCTTTAGTAAGACTCTAAGTCTGTGACACCATTTTGTTGATGTTATCTATGTGAAGAACAAATGGAGACAGCCTTCCATATCTTTTTGCATTTTAAATA
GGCAAACCAACTGTGGCAGATGTTCTTACACAAGAGGAAGATCAGGTGGGTGAAACCTGGGGGAATCAAAGAAGTGCTAAAAAGTTGAAAAAATTATAGA
AATGTAGGAGAAAGGAAGAGATATAGAAGATGAATCCTACATATATCTCATTGACCATATGGTAGGAAACAAATCAGAGACATTTTGAAGGCAAAAAGAG
CAACATACAGAAGATCAAGACAGACTATTTATGCCTTTACTATTTTTGGTGTAAACAAGTAGCTATAAACAACATTCAAAATGTACTTAATGCAATTGAC
CGGTTGTAATTAGAATAATTAGGATTTTGTAAAGAGAATTTTGTGATGGGGTACTATACTTTGTTGTAGTACACCTATGAATATATAGAAGTAAATTTTA
TCATTCTCAAAAAAAATAATTATGGATACTCTCTCAAACTATGAAGCAGTAAATGGACAAAACTACACAAAGATGAGTGTTTTTGTTTCTTTATCATAAT
GTGACTCCAGAGGTAAAACATAAGGTGTTTGAAATTACAAAAATTCCTAAAAAGCAGTTCCCCTTTACATACTTGGGAGTACCAATTTGTCACGGGAAAA
GACTGATTGTTCATCAAAAAGAGATCATAGACAAGATATTCAATAGACTCAATTCTTTG

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.930333
Expected error %
0.4442
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0013M07
Clone
Clone name
hba-13m7
LE_HBa0013M07
P013M07
Clone type
BAC
Contamination
none
Estimated length
84,777
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found