Clone Read LE_HBa0014A17_T7_128662

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0014A17_T7_128662
Primer
T7
ID from Seq. Facility
LE_HBa_014_A17-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
713 trimmed for vector and quality, 915 raw
Genbank Accession
Sequence
>LE_HBa0014A17_T7_128662 (raw untrimmed)
GGGGACCCGGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTCGATTTGAATGAAGAAGAGGTACGGCTAGCCGGTGCCTTCTGGGTACCGTTTC
TGTATCCACCAGAAGCCATAACTCTCTGGAAATGGAGGTGTTTGATTGTAGAGAGAGAGAAAAACAGGGAAGATGAACAACTTTATTTAACTCTTTTTTG
GGTTCAAATTGAAGGGAATATGGAAAGAGAAAGATGGTGTGTGGGTCCAACTTGCGGTGAATACTTAAGCCGAGAGTGAAGTGAAGCTGCCGAGACTTAA
ATATTTTTTAAAAATAATAGAGTAAGAAACAAAGAATAAGAAAAAAAAAAACAGACTTGTCGGGGTACAGAAGGTGACTGACTGAGAAAGTGAGAAGTAT
GGGGTTAGATTTTGAGGTGAAAGTACAATTATACCACCAAATTACCATTATTTCTTTCATTATTGCAAGAAATTATTTACTCTATAATGAAATTAAATTT
AAATACCATCCTAGGATATAGTAAATGAGAAAAATATTTGATAGGGAGTTTTTCCTCTTGAATGGGGCCTACTCGGAAAAATAACGTCGGTCAAGGTTAG
TCGGTTAGGTGCATATTAGTTAGGTGATGACAGACGAGGCTCAATAACATCGACTAAAGCTTGCACAGACAACATTGATCGAAGCCATGCGACATCAGTC
AAGGTTTGCGTGTATTGGACATGCGACGTCAACTAATACAAAGTGTCATCAGTCAAGCAACGTCCCACAAAGCTAGGCCCCATCCGGCGAAGGCCTGGTC
GTAGGCTAGCGAACTTTATTGGACACTTATTTAAATTAATCCAAGCTTCCAATATTGGATTATGAAACCTCCAAATTGAAATTTTAAAAAAAAGAAAAAA
AAAAAAATTTTAAAT
>LE_HBa0014A17_T7_128662 (trimmed for quality and cloning vector)
AGCTTCGATTTGAATGAAGAAGAGGTACGGCTAGCCGGTGCCTTCTGGGTACCGTTTCTGTATCCACCAGAAGCCATAACTCTCTGGAAATGGAGGTGTT
TGATTGTAGAGAGAGAGAAAAACAGGGAAGATGAACAACTTTATTTAACTCTTTTTTGGGTTCAAATTGAAGGGAATATGGAAAGAGAAAGATGGTGTGT
GGGTCCAACTTGCGGTGAATACTTAAGCCGAGAGTGAAGTGAAGCTGCCGAGACTTAAATATTTTTTAAAAATAATAGAGTAAGAAACAAAGAATAAGAA
AAAAAAAAACAGACTTGTCGGGGTACAGAAGGTGACTGACTGAGAAAGTGAGAAGTATGGGGTTAGATTTTGAGGTGAAAGTACAATTATACCACCAAAT
TACCATTATTTCTTTCATTATTGCAAGAAATTATTTACTCTATAATGAAATTAAATTTAAATACCATCCTAGGATATAGTAAATGAGAAAAATATTTGAT
AGGGAGTTTTTCCTCTTGAATGGGGCCTACTCGGAAAAATAACGTCGGTCAAGGTTAGTCGGTTAGGTGCATATTAGTTAGGTGATGACAGACGAGGCTC
AATAACATCGACTAAAGCTTGCACAGACAACATTGATCGAAGCCATGCGACATCAGTCAAGGTTTGCGTGTATTGGACATGCGACGTCAACTAATACAAA
GTGTCATCAGTCA

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.957268
Expected error %
0.5782
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0014A17
Clone
Clone name
hba-14a17
LE_HBa0014A17
C03HBa0014A17
P014A17
Clone type
BAC
Contamination
none
Estimated length
105,654
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found