Clone Read LE_HBa0014H24_T7_129012

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0014H24_T7_129012
Primer
T7
ID from Seq. Facility
LE_HBa_014_H24-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
665 trimmed for vector and quality, 888 raw
Genbank Accession
Sequence
>LE_HBa0014H24_T7_129012 (raw untrimmed)
CCTCGGACCCGGGGCTCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTGCCCAAACCTCATCACACCCTTCATCGGTGATACTCGGAGCCAAACATGATC
ACCCTCCATAAACACTCATTCTCTAACTCTCCGGTCTGCATAACTCTTTTGTCGACTCTGGGCTGTCAACAGTCTATACTGAATCATACGGACTTGTTCC
ATAGCATCTCTAAGCAAGTCTGTATCCAAAGAGTCCATCTCCGCCGAATCAAACCAACCAATAGGAGATCTACACCGTCTACCATACAATGCCTCAAATG
GGGCCATTTGGATACTAGAGTGATAACTGTTATTATAGGCAAACTCCACTAAGGGTAAATGTCGATCCCATCTTGCACCAAAATCGATCACACACGCTCG
AAGCATATCTTCCAATACCTGAATGGTCCGCTCAGATTGACTATCTGTCTGAGGGTGAAATGCCGTACTCATATCTAACTGAGTACCCAGACCATGTTGT
AATGCCTTCCAGAAGTGAGAAGTAAATAGTGAACCTCGATCTGATATGATAGAAACAGGAACTTCATGTAGTCGCACAATCCTGACTGATATATAGTTCG
GCTAACTTTTCTGCTGTATACTTTACCCAAACCGGGATGAAGTGGGCAGACTTGGTCAGCCTATCAACCAAACAACCCAAATAGAGTCATAACCCACCCA
GTGTGGGTAGGAAAAACCCACAAAAAAGTCCATAATAAATCCTCTTCCCACTTTCAAAGTAGGGAATTGGGCATCCCTCCTGAAAATACACCCCCCGGGG
CCGGCGGGGTGCTCCCCACTTGAACCCTGGCTGGGGAAATTCAAAACACCCTTCTAAAAACAAAATTTCTCATGAAAGTTTTTCTTTT
>LE_HBa0014H24_T7_129012 (trimmed for quality and cloning vector)
AGCTTGCCCAAACCTCATCACACCCTTCATCGGTGATACTCGGAGCCAAACATGATCACCCTCCATAAACACTCATTCTCTAACTCTCCGGTCTGCATAA
CTCTTTTGTCGACTCTGGGCTGTCAACAGTCTATACTGAATCATACGGACTTGTTCCATAGCATCTCTAAGCAAGTCTGTATCCAAAGAGTCCATCTCCG
CCGAATCAAACCAACCAATAGGAGATCTACACCGTCTACCATACAATGCCTCAAATGGGGCCATTTGGATACTAGAGTGATAACTGTTATTATAGGCAAA
CTCCACTAAGGGTAAATGTCGATCCCATCTTGCACCAAAATCGATCACACACGCTCGAAGCATATCTTCCAATACCTGAATGGTCCGCTCAGATTGACTA
TCTGTCTGAGGGTGAAATGCCGTACTCATATCTAACTGAGTACCCAGACCATGTTGTAATGCCTTCCAGAAGTGAGAAGTAAATAGTGAACCTCGATCTG
ATATGATAGAAACAGGAACTTCATGTAGTCGCACAATCCTGACTGATATATAGTTCGGCTAACTTTTCTGCTGTATACTTTACCCAAACCGGGATGAAGT
GGGCAGACTTGGTCAGCCTATCAACCAAACAACCCAAATAGAGTCATAACCCACCCAGTGTGGGT

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.968121
Expected error %
0.9668
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT66771.1| Score 266 E Value 3e-70 Identity 21.80% Align. Length 647bp (97.29%) Frame 2
putative polyprotein [Solanum demissum]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT38745.1| Score 265 E Value 6e-70 Identity 22.00% Align. Length 635bp (95.49%) Frame 2
putative polyprotein, 3'-partial [Solanum demissum]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0014H24
Clone
Clone name
hba-14h24
LE_HBa0014H24
P014H24
Clone type
BAC
Contamination
none
Estimated length
64,505
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found