Notice: SGN will be briefly unavailable for maintenance. Apologies.

Clone Read LE_HBa0014I13_SP6_129037

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0014I13_SP6_129037
Primer
SP6
ID from Seq. Facility
LE_HBa_014_I13-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
408 trimmed for vector and quality, 875 raw
Sequence
>LE_HBa0014I13_SP6_129037 (raw untrimmed)
AAGAACGGTGGGCTTGGATCGAACTCAAAAGAATCCGTTATAGGGGATNNGGGTGTNANGTTNNNGANANNAGGATAGTTCTTTTGGGTGGGGTGTNANG
TTNNGANANN
AGGATAGTAGTAGTAGATTGAGTGTGANGTTNNGAGANTAGGATAGTAATAATGGATGGGGTGTNATGTTNNGANANTAGGATAGTAGTA
GTGGATNGGGTGTNANGTTNNGANANNAGGATAGTAATAATGGATGGGGTGTNANGTTNTGANANNAAGATAGTAGTAGAGGATNGGAGTGTNANATTNN
GATANTAGGATAGTAAAAAGAATGAATNTTGAATNATGTTAATATAGTTAGATTTTAAAGAAGATATTTTNNTAAANGAGTATGGTGTGGAGGTGTGAGN
TTTAATAAATGTGNTTGGGTTGTGGNNAATGGTTANGGTANTTGTTGTTGTTATNTTTTGAGTATTGTAGTTGATTTTATGTTATTATATGATATATATT
GTTTTNTATTTTGAGTTGGNNGATGATANNTANTNAGTANTTGTGGNTTGTANTGANNNGTANTTGTATGTTTNTTTNTTTGTTATTTGTGGAGTGGAGN
AAANGTGNNAANAANTTNGAATNAANNGNAANTTTAGNNAGAATTNAGNATAATAAGATTTTAGGGGTGAGTTATTGTTTTTAGTTTGGATTGGATTNTT
TTTTTTAAGTTTTGATATTTTGAAGTTGGGAAATGGAAAATTTGTTTATTTATTTTAGGTTTTTAGTTAATTTTAAAATTATAAATTAAAAATAGATGTT
TTTGGTGGTGATGAATTTTTAGATTTTTGAAAAAGGAAAAGTTATGGGAGTTTTTAAAAAGGTTTTTTTAAATTG
>LE_HBa0014I13_SP6_129037 (trimmed for quality and cloning vector)
AGGATAGTAGTAGTAGATTGAGTGTGANGTTNNGAGANTAGGATAGTAATAATGGATGGGGTGTNATGTTNNGANANTAGGATAGTAGTAGTGGATNGGG
TGTNANGTTNNGANANNAGGATAGTAATAATGGATGGGGTGTNANGTTNTGANANNAAGATAGTAGTAGAGGATNGGAGTGTNANATTNNGATANTAGGA
TAGTAAAAAGAATGAATNTTGAATNATGTTAATATAGTTAGATTTTAAAGAAGATATTTTNNTAAANGAGTATGGTGTGGAGGTGTGAGNTTTAATAAAT
GTGNTTGGGTTGTGGNNAATGGTTANGGTANTTGTTGTTGTTATNTTTTGAGTATTGTAGTTGATTTTATGTTATTATATGATATATATTGTTTTNTATT
TTGAGTTG

This is probably not a useful sequence.

Problems:
  • High predicted error rate
Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.933853
Expected error %
19.0075
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0014I13
Clone
Clone name
hba-14i13
LE_HBa0014I13
P014I13
Clone type
BAC
Contamination
none
Estimated length
99,747
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found