Clone Read LE_HBa0014I13_T7_129038

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0014I13_T7_129038
Primer
T7
ID from Seq. Facility
LE_HBa_014_I13-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
704 trimmed for vector and quality, 931 raw
Genbank Accession
Sequence
>LE_HBa0014I13_T7_129038 (raw untrimmed)
TTGGATCCGGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTCAACAGCAATTACAAAACTATGCAATCTTTATAACTTTGATAGTTCAAAATTG
GGGGAAAAGGCATATGTTTTTTGGGTCTGATACGGGTAATAAAAGGGGTATAATTGAACCATAAAATATGGGTAATAAAAGGGTTTAATGGGCCGAATTT
TTAGGGGCATATTTGACCCTTTCTCTTTTGTAATATAAATGCCACGCTGTAATATTAAAATTACGTGGAAAATCCATTTGGGTAATTAAAAAAAAGTAAA
ATGCGTTGGATATTTTGAGGTGACCAACTAACGCCCATAAGGGCTTATTTGTACTAATAATTGGACGGCGAGGGTATAAATGGACCAAACTTTTAACGGG
GGACATATTTAAACCTTTTCGAAAAGTACAGGGGTATATTTGACCCTTTTCCCTATTTTAAGATAATATTTTTTAAAAAAATTATATTTATCGAATTATC
CTTATTTAAAATCAGATATAATATATAAATATGTCGTTTAATTTGATCTCATTTTACGTCTTTCAACATAAGTGTGTCAAGAGGATGCACGTTTATGTTT
ATTTGTTCAATTTAATACAAGTTTAAGTTTCTATTTATACACACACAAATTAAAGATATAAATATAAATAAAGTCAAATTACAACATATTTTATATAACA
ATGCCTTAAAGCTATTTTAATATTTTATTTTAAATTGACGTTTTTTTTACATAAAAATATTTTAGAGATACCGTTGAAATAATGCTTTTTAAATAAATTG
TCAAAAAAAAGATATGTTGACTTTTTTTTTTTTAAAATGATTCCTTTTGGTTAATTCTATATTTAACCGGAATTTTTTTGGAGGCCAAAATTAAACCCCT
TTTTTTTTAGGTTAAAAAAAATTTTTTTTTT
>LE_HBa0014I13_T7_129038 (trimmed for quality and cloning vector)
AGCTTCAACAGCAATTACAAAACTATGCAATCTTTATAACTTTGATAGTTCAAAATTGGGGGAAAAGGCATATGTTTTTTGGGTCTGATACGGGTAATAA
AAGGGGTATAATTGAACCATAAAATATGGGTAATAAAAGGGTTTAATGGGCCGAATTTTTAGGGGCATATTTGACCCTTTCTCTTTTGTAATATAAATGC
CACGCTGTAATATTAAAATTACGTGGAAAATCCATTTGGGTAATTAAAAAAAAGTAAAATGCGTTGGATATTTTGAGGTGACCAACTAACGCCCATAAGG
GCTTATTTGTACTAATAATTGGACGGCGAGGGTATAAATGGACCAAACTTTTAACGGGGGACATATTTAAACCTTTTCGAAAAGTACAGGGGTATATTTG
ACCCTTTTCCCTATTTTAAGATAATATTTTTTAAAAAAATTATATTTATCGAATTATCCTTATTTAAAATCAGATATAATATATAAATATGTCGTTTAAT
TTGATCTCATTTTACGTCTTTCAACATAAGTGTGTCAAGAGGATGCACGTTTATGTTTATTTGTTCAATTTAATACAAGTTTAAGTTTCTATTTATACAC
ACACAAATTAAAGATATAAATATAAATAAAGTCAAATTACAACATATTTTATATAACAATGCCTTAAAGCTATTTTAATATTTTATTTTAAATTGACGTT
TTTT

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.904139
Expected error %
0.5269
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0014I13
Clone
Clone name
hba-14i13
LE_HBa0014I13
P014I13
Clone type
BAC
Contamination
none
Estimated length
99,747
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found