Clone Read LE_HBa0015A04_SP6_129403

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0015A04_SP6_129403
Primer
SP6
ID from Seq. Facility
LE_HBa_015_A04-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
786 trimmed for vector and quality, 952 raw
Genbank Accession
Sequence
>LE_HBa0015A04_SP6_129403 (raw untrimmed)
GAAATCGAAAACAGAAGCAAAATAGGTTTTCTACGCCTNTTGAAGACTAGCATGAGGCTAACGTGTGAAGAAGACTCACTTCTTGTAGATCCCAAATCTT
ACCGAGCTCTTGTAGGAAGTCTCTTGTATTTGACTATTACTACAAAGAGGATTTTAAAGTATAGCAACTTAACATCAGATATGGACCTATTTTTAAAAGA
AAAAATGGCTTGATACTGACGCAGATTTTGATGGTGATATAGATAATCGAAGATCTACATTAGACTATATTTTTCTTTGTGGTGGAATAGGGATTTCTTG
GTGCATCAAGAAGAAGACTCAATTTCTTTATCAATTATGGAGGCAGAATATAAAGCACTAACTCTTACTATTCAAGAATGTGTATCACTCCAAAGACTTG
CTAAAAATTCTCATCTATCTATATCAAAGCCAACTACAATCTGCGGAGACAACCAATGCGCCATCAAGCTTGCAAACAATTCGATATTTCATGCAAGAAC
TAAGCATATTGAGGTGAAACGTTATCATTTCATTCGAGAAAAAGCTCTTGATAGAACTTTATATACGCGGAGGTACGAAATCAGGAGAATATTACAAATA
TCTTCACCAAATCACTTTCAAAAACTTCTTTTGAATTTTCTCGCGGCAAGATTGGGATAGTTCCAAAAACTTACTTTAAGGGGGAGTATGAAAGAAGTTA
AAAATGATTTTTTGAATAGCATAGATTTTTCTAGAATATCCTATAGTAGAAATTTAGAAATTATCTTGAATAAATATCTAGATGTACTAGAAAAGTTGTA
TCCTAAAAAGATATCTGGATATTTCTTGTAGATGTATCTAGAAAAAGTTCTAGAATTATCTATAGACAAGTATAAATAGGGGATGGTCTCGTACATTTGC
ATTTCAAGAAAAAAACCGTTTTAAGAGTCTTCTTTCATATCTAGTCCTCTTA
>LE_HBa0015A04_SP6_129403 (trimmed for quality and cloning vector)
TTTCTACGCCTNTTGAAGACTAGCATGAGGCTAACGTGTGAAGAAGACTCACTTCTTGTAGATCCCAAATCTTACCGAGCTCTTGTAGGAAGTCTCTTGT
ATTTGACTATTACTACAAAGAGGATTTTAAAGTATAGCAACTTAACATCAGATATGGACCTATTTTTAAAAGAAAAAATGGCTTGATACTGACGCAGATT
TTGATGGTGATATAGATAATCGAAGATCTACATTAGACTATATTTTTCTTTGTGGTGGAATAGGGATTTCTTGGTGCATCAAGAAGAAGACTCAATTTCT
TTATCAATTATGGAGGCAGAATATAAAGCACTAACTCTTACTATTCAAGAATGTGTATCACTCCAAAGACTTGCTAAAAATTCTCATCTATCTATATCAA
AGCCAACTACAATCTGCGGAGACAACCAATGCGCCATCAAGCTTGCAAACAATTCGATATTTCATGCAAGAACTAAGCATATTGAGGTGAAACGTTATCA
TTTCATTCGAGAAAAAGCTCTTGATAGAACTTTATATACGCGGAGGTACGAAATCAGGAGAATATTACAAATATCTTCACCAAATCACTTTCAAAAACTT
CTTTTGAATTTTCTCGCGGCAAGATTGGGATAGTTCCAAAAACTTACTTTAAGGGGGAGTATGAAAGAAGTTAAAAATGATTTTTTGAATAGCATAGATT
TTTCTAGAATATCCTATAGTAGAAATTTAGAAATTATCTTGAATAAATATCTAGATGTACTAGAAAAGTTGTATCCTAAAAAGATA

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.947388
Expected error %
0.4357
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At4g23160.1 Score 63 E Value 1e-12 Identity 39.50% Align. Length 334bp (42.49%) Frame 3
68417.m03342 protein kinase family protein contains Pfam domain PF00069: Protein kinase domain
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAB61111.1| Score 75 E Value 3e-12 Identity 12.00% Align. Length 599bp (76.21%) Frame 2
Strong similarity to Zea mays retrotransposon Hopscotch polyprotein (gb|U12626). [Arabidopsis thaliana] pir||G96722 hypothetical protein F20P5.25 [imported] - Arabidopsis thaliana
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
emb|CAE04695.1| Score 75 E Value 2e-12 Identity 9.30% Align. Length 599bp (76.21%) Frame 2
OSJNBb0015D13.14 [Oryza sativa (japonica cultivar-group)]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0015A04
Clone
Clone name
hba-15a4
LE_HBa0015A04
C12HBa0015A04
P015A04
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found