Clone Read LE_HBa0015A04_T7_129404

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0015A04_T7_129404
Primer
T7
ID from Seq. Facility
LE_HBa_015_A04-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
860 trimmed for vector and quality, 965 raw
Genbank Accession
Sequence
>LE_HBa0015A04_T7_129404 (raw untrimmed)
TCTAACCTGGTACCGGGGGTATCTCTAGAGTCGACCTGCAGGCATGCAAGCTTTTAAGATGATCCCTACAATAATACGGTTAAAGAGGGGTACCCATATT
ATTCATTGGGTAACTCCTCTTTAAGGGTTAAAATATGAGTAGAGCATTTAACCCATTTTTAATGAACTAGTTTATCATACTCATATTCAACTCAACACGC
TCATATGCCGCTCCTACAAACAATCTTTCTTTTCCTAAAATTCTTCCATCATCAATATCACCCCTTAGTAGCCAACCATGTGAAAAGCACACCTTCCTCA
ACACCTTAGGTATCGAGACCAAATCATAAGAGAAACTAACATCCATCCTAACCAAAAGTTTCTCATAGATAGACTTGACAGAGAACACTTTGTTATTTCT
CAACTTCCAACTCAAAGCATCAGGTCTATTGATGGGCTCACATTGCTTGTGAATTAAAGTTCGCAATCTCGGGAATTCGTTCACCTCCCAATTCTGCAAA
TTCCTCCTAAACCTCAAATCCCAAAATCCCATTCTGTCCCCCTAACTTGCTGGACAAACAATTCCCTTTGGCAAGAGGCCTTATACAACACCAGAAAATC
ATCTTTTAGCACCACACCACTTTTCGCCCCGAAAACCAACTTTATTCCCAACCCATACCTTAAAAGAATGTTTTTAAAGGTTTTCCAACCCTTCAATATA
TTCCTCCACACCACATCCATAAGTCATAGTAACTTTGTTCTCCGCCACCCCCCTCTTCAATTCCCCATTCCAGTACTCCATATTTCTCTGCTATCACCTC
TCCCTAAAGCTTCCCCCTCCACCCAAATCTCCACAACCACTTGCCCAAAAGTGGCTTGTTGAAACTCATCATTTTGGCATTGTCAATGTCTCCCCACAAA
CTAAGTGAAACTCCTTAGCCCCCTTTACCGCCTCCCGAAAACAATTTTTGCAACTTTGCAATGGT
>LE_HBa0015A04_T7_129404 (trimmed for quality and cloning vector)
AGCTTTTAAGATGATCCCTACAATAATACGGTTAAAGAGGGGTACCCATATTATTCATTGGGTAACTCCTCTTTAAGGGTTAAAATATGAGTAGAGCATT
TAACCCATTTTTAATGAACTAGTTTATCATACTCATATTCAACTCAACACGCTCATATGCCGCTCCTACAAACAATCTTTCTTTTCCTAAAATTCTTCCA
TCATCAATATCACCCCTTAGTAGCCAACCATGTGAAAAGCACACCTTCCTCAACACCTTAGGTATCGAGACCAAATCATAAGAGAAACTAACATCCATCC
TAACCAAAAGTTTCTCATAGATAGACTTGACAGAGAACACTTTGTTATTTCTCAACTTCCAACTCAAAGCATCAGGTCTATTGATGGGCTCACATTGCTT
GTGAATTAAAGTTCGCAATCTCGGGAATTCGTTCACCTCCCAATTCTGCAAATTCCTCCTAAACCTCAAATCCCAAAATCCCATTCTGTCCCCCTAACTT
GCTGGACAAACAATTCCCTTTGGCAAGAGGCCTTATACAACACCAGAAAATCATCTTTTAGCACCACACCACTTTTCGCCCCGAAAACCAACTTTATTCC
CAACCCATACCTTAAAAGAATGTTTTTAAAGGTTTTCCAACCCTTCAATATATTCCTCCACACCACATCCATAAGTCATAGTAACTTTGTTCTCCGCCAC
CCCCCTCTTCAATTCCCCATTCCAGTACTCCATATTTCTCTGCTATCACCTCTCCCTAAAGCTTCCCCCTCCACCCAAATCTCCACAACCACTTGCCCAA
AAGTGGCTTGTTGAAACTCATCATTTTGGCATTGTCAATGTCTCCCCACAAACTAAGTGA

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.946331
Expected error %
1.0952
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0015A04
Clone
Clone name
hba-15a4
LE_HBa0015A04
C12HBa0015A04
P015A04
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found