Clone Read LE_HBa0015E20_T7_129628

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0015E20_T7_129628
Primer
T7
ID from Seq. Facility
LE_HBa_015_E20-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
757 trimmed for vector and quality, 963 raw
Genbank Accession
Sequence
>LE_HBa0015E20_T7_129628 (raw untrimmed)
GGCTACCTGGTCCCGAGGGGACCTCTAGAGTCGACCTGCAGGCATGCAAGCTTCTAGACGCCCATTGGCTAGAGACCTTTAGAGGCTAGCTAATGACTTG
ATGAGATTAGAAGTAAATCCTTAGGGAGGATTGTTGGCTTTTGTGGAGGCAAGATCTTCCTTTCTTGACAAGATTAAGGGAAGACAGTTCGATGATGAGA
AACTGCGCAGAATCCAAGATAAGGTATTGCGAGGAGAGGCTAAGGAAGCACAAATCGATGAGGAAGGTGTTTTGAGAATCAAGGGAAGGGTATGTGTACC
CCGAGTTGATGATTTGATCAACACTATTCTGACAGAGGCTCATAGTTCAAAGTATTCGATACATCCGGGTGCAACCAAGATGTACCGTGACCTAAAGCAA
CACTTTTGGTGGAGTAGAATGAAGCGTGATATTGTTGATTTTATTGCCAGATGTCCAAACTGTCAACAAGTAAAGTATGAACACCAGAGGCCCGGAGGAA
CCCTTCAGAGAATGCCCATTCCGGAATGGAAGTGGGAAAGAATTGCAATGGACTTTGTGGTTGGTCTTCCCAAGACAATGGGTAAGTATGACTCCATTTG
GGTGATTGTTGATAGGTTAACTAAATCTGCTCATTTTATTCCGTTTAAGGTGACTTACAATGCCGAGAAGTTAGCCAAGATCTATATCTCAGAAATCGTT
CGATTGCATGGGGTTCCACTATCCATCATATCAGATAGAGGTACGCAGTTTACTTCTAAGTTTTGGAAAACATTGCATGGGGAAATTGGGTACTAGGTTG
GACCGTAATACTGCTTTCCCTCCTCAAACCGATGGTCATTTCTACCGAACGATCAAGGGTTGGAGGATAGCTTCGTGCTGTGGTGATAGATTTGGTGGTC
CTGGGAAAGCTTTTTCCCTTAGCGAATTTCCTACAAAATAACTTTACCTCCCCCTTAATTGGT
>LE_HBa0015E20_T7_129628 (trimmed for quality and cloning vector)
AGCTTCTAGACGCCCATTGGCTAGAGACCTTTAGAGGCTAGCTAATGACTTGATGAGATTAGAAGTAAATCCTTAGGGAGGATTGTTGGCTTTTGTGGAG
GCAAGATCTTCCTTTCTTGACAAGATTAAGGGAAGACAGTTCGATGATGAGAAACTGCGCAGAATCCAAGATAAGGTATTGCGAGGAGAGGCTAAGGAAG
CACAAATCGATGAGGAAGGTGTTTTGAGAATCAAGGGAAGGGTATGTGTACCCCGAGTTGATGATTTGATCAACACTATTCTGACAGAGGCTCATAGTTC
AAAGTATTCGATACATCCGGGTGCAACCAAGATGTACCGTGACCTAAAGCAACACTTTTGGTGGAGTAGAATGAAGCGTGATATTGTTGATTTTATTGCC
AGATGTCCAAACTGTCAACAAGTAAAGTATGAACACCAGAGGCCCGGAGGAACCCTTCAGAGAATGCCCATTCCGGAATGGAAGTGGGAAAGAATTGCAA
TGGACTTTGTGGTTGGTCTTCCCAAGACAATGGGTAAGTATGACTCCATTTGGGTGATTGTTGATAGGTTAACTAAATCTGCTCATTTTATTCCGTTTAA
GGTGACTTACAATGCCGAGAAGTTAGCCAAGATCTATATCTCAGAAATCGTTCGATTGCATGGGGTTCCACTATCCATCATATCAGATAGAGGTACGCAG
TTTACTTCTAAGTTTTGGAAAACATTGCATGGGGAAATTGGGTACTAGGTTGGACCG

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.968743
Expected error %
1.1929
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT66771.1| Score 312 E Value 5e-84 Identity 21.50% Align. Length 659bp (87.05%) Frame 3
putative polyprotein [Solanum demissum]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT38745.1| Score 310 E Value 2e-83 Identity 21.40% Align. Length 659bp (87.05%) Frame 3
putative polyprotein, 3'-partial [Solanum demissum]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0015E20
Clone
Clone name
hba-15e20
LE_HBa0015E20
P015E20
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found