Clone Read LE_HBa0015J24_T7_129876

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0015J24_T7_129876
Primer
T7
ID from Seq. Facility
LE_HBa_015_J24-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
843 trimmed for vector and quality, 922 raw
Genbank Accession
Sequence
>LE_HBa0015J24_T7_129876 (raw untrimmed)
CCTCGCCGGGACCGGGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTAATTGGAGTGCACCAAAAGATGCCCCTTGGGGGAGTTCAACTGGGAA
TCTATGTTGCAACTCTTTCCTTGAGGTTGCAATTTTACTACGGGCATCGGATTCTCTAGTCCATGATCTGTGCCATGTGTATGATTCCTGCAGTGATAAG
ACTGTCTCAAGGCCCCCAAAGTTTTTTCTTGCACTTCGCAAATGGTACTCATCCCTGCGGCCCGAGATGGAATTTCGCTGCTTTGTACGCAATGGGATCC
TTGTGGGGGTCTCTCAGCGCGAGGTGACTGGATTTTATCCTGCTCTTGTTGAGAAGAAAGATGAGCTGATAACAATAGTCCAGAGATTTTTTATGTATAA
GGTGAAGGGAAATTTTGAATCAGAAAGTTATACTTTTGATATATATGTCACAAATGATGACCGAGTTAAGCTTTTGGATTTTAATCCTTGGGGCGCATTT
ACCTTACCTTTGCTTTTCACCTGGGAGGAATTAGAAGTTAATTCGAATAAAGAGGGAGATCACTTGGAGTTTAGACTTGTAGAAAGCCAGTGTGGGGTTC
GTCCTGGTTTGAAAACTGCTGTTCCTTATGATTACCTGGATACTAGTCCAGGTAGTGGTTGGGATGAGTTTCTTAAAAAGGCTGATGAGGAATTGGGACA
ACAGATCAGGTCTCCTCAAGCAGGTGCTTGATTGCTAGATGTTCAATGACGGTAAGAGACATTTTTCGAGTAATTAACCAATAATGTCCGTGTGGTTTGT
TTTATTGTTCTTGACGTTATGTAAGCCGGATTTGATCTTTCTCATTTATTCCTAATTCATTTCTTTTCAGATGATTCCTCCTTTTTTTTCTTTATATAGT
AGGAATATTATGTGAAAAATCT
>LE_HBa0015J24_T7_129876 (trimmed for quality and cloning vector)
AGCTTAATTGGAGTGCACCAAAAGATGCCCCTTGGGGGAGTTCAACTGGGAATCTATGTTGCAACTCTTTCCTTGAGGTTGCAATTTTACTACGGGCATC
GGATTCTCTAGTCCATGATCTGTGCCATGTGTATGATTCCTGCAGTGATAAGACTGTCTCAAGGCCCCCAAAGTTTTTTCTTGCACTTCGCAAATGGTAC
TCATCCCTGCGGCCCGAGATGGAATTTCGCTGCTTTGTACGCAATGGGATCCTTGTGGGGGTCTCTCAGCGCGAGGTGACTGGATTTTATCCTGCTCTTG
TTGAGAAGAAAGATGAGCTGATAACAATAGTCCAGAGATTTTTTATGTATAAGGTGAAGGGAAATTTTGAATCAGAAAGTTATACTTTTGATATATATGT
CACAAATGATGACCGAGTTAAGCTTTTGGATTTTAATCCTTGGGGCGCATTTACCTTACCTTTGCTTTTCACCTGGGAGGAATTAGAAGTTAATTCGAAT
AAAGAGGGAGATCACTTGGAGTTTAGACTTGTAGAAAGCCAGTGTGGGGTTCGTCCTGGTTTGAAAACTGCTGTTCCTTATGATTACCTGGATACTAGTC
CAGGTAGTGGTTGGGATGAGTTTCTTAAAAAGGCTGATGAGGAATTGGGACAACAGATCAGGTCTCCTCAAGCAGGTGCTTGATTGCTAGATGTTCAATG
ACGGTAAGAGACATTTTTCGAGTAATTAACCAATAATGTCCGTGTGGTTTGTTTTATTGTTCTTGACGTTATGTAAGCCGGATTTGATCTTTCTCATTTA
TTCCTAATTCATTTCTTTTCAGATGATTCCTCCTTTTTTTTCT

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.969598
Expected error %
1.3845
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At4g05440.1 Score 274 E Value 4e-74 Identity 20.10% Align. Length 662bp (78.53%) Frame 1
68417.m00826 temperature sensing protein-related contains weak similarity to D123 (GI:1236114) [Rattus norvegicus]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
emb|CAB81086.1| Score 274 E Value 2e-72 Identity 20.10% Align. Length 662bp (78.53%) Frame 1
D123-like protein [Arabidopsis thaliana] ref|NP_192453.1| temperature sensing protein-related [Arabidopsis thaliana] pir||D85068 D123-like protein [imported] - Arabidopsis thaliana
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAS38774.1| Score 151 E Value 2e-35 Identity 13.60% Align. Length 608bp (72.12%) Frame 1
similar to Homo sapiens (Human). HT-1080 protein (D123 gene product) (Hypothetical protein) [Dictyostelium discoideum] gb|EAL69364.1| hypothetical protein DDB0169525 [Dictyostelium discoideum]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0015J24
Clone
Clone name
hba-15j24
LE_HBa0015J24
P015J24
Clone type
BAC
Contamination
none
Estimated length
125,667
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found