Clone Read LE_HBa0017C15_SP6_130289

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0017C15_SP6_130289
Primer
SP6
ID from Seq. Facility
LE_HBa_017_C15-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
571 trimmed for vector and quality, 948 raw
Genbank Accession
Sequence
>LE_HBa0017C15_SP6_130289 (raw untrimmed)
AAGTTTGGAGTAGCAATCTAGATATGTCTTGGTCCTGAAGTCATAACTTTACTGAGAGTTAAATGTGTTTATTGTTTTCTTCTCGGATTTTCATATTTTT
AAAACAGGGCTATGCTGGAGCTGGATCAAATTCTTAGGGCCAATGAAATCAATTTTGCTATTTTAGCTGCTCTGCCCGCTTTCTTCCTCTCTCTTATTGT
GATCATGTTGGTGCGTGCTTGGCTTAAACAGGTAAAGTAGCTTGTTTTCGTTTAAAAATCAATTTGTGTCATATATTATTCCATTAAAAATAATTGTAAA
AGGGATCAGGATTTGTCACATGAGAGACAAAGAGGAGGAACAGGGTTCTATTCCCACACTTATTAAGCCCCCCCCCCCCCCCCCCACTCTCCTCACGCAG
TTCTTGAAGCCTCTACTTTTGATGAGCTATATCAGCTGGTTCGGCTACTACCTCTACTTTTTTTATCCTGTTTGTAAGATTATTGAAGGAGATGTTGGTC
ATAAATTCAGAGTTAGAGAGTACTGGATTATGGGAGGCAATGAGGGAACCTACTTCTGATGTCATCAAAAAAAAAGATCGGAAAGAGTTCCCTGGGGAAA
GAGATTGAGGTAGGAGTTTTCTGATGAGGGAGGCTTGTTATGCCATTCACAGAAACATTTACTAATGATATTAACACAATGATAAATTCTCTCTAATGTA
CACAATTGTTATATCCTCTTTATTGGACACTTTTGATTCTATTTTTAAACCAAAAAAATGAACCATTTTTGGCTCAAAACAACTTCAACGGAATTAATAT
ACATTTTCCTTTTCCCCTCCAATGCTATTGAACTTAAGGAAATGAATATTATTTTATACCTCCGAAAAAACCAAATTATTTTCCCATTTTTTCTCGCTTT
ATTTTAATAATGCAAAAAAAACTCTTTTAAGACATCTTCTTTACCTTT
>LE_HBa0017C15_SP6_130289 (trimmed for quality and cloning vector)
TTTATTGTTTTCTTCTCGGATTTTCATATTTTTAAAACAGGGCTATGCTGGAGCTGGATCAAATTCTTAGGGCCAATGAAATCAATTTTGCTATTTTAGC
TGCTCTGCCCGCTTTCTTCCTCTCTCTTATTGTGATCATGTTGGTGCGTGCTTGGCTTAAACAGGTAAAGTAGCTTGTTTTCGTTTAAAAATCAATTTGT
GTCATATATTATTCCATTAAAAATAATTGTAAAAGGGATCAGGATTTGTCACATGAGAGACAAAGAGGAGGAACAGGGTTCTATTCCCACACTTATTAAG
CCCCCCCCCCCCCCCCCCACTCTCCTCACGCAGTTCTTGAAGCCTCTACTTTTGATGAGCTATATCAGCTGGTTCGGCTACTACCTCTACTTTTTTTATC
CTGTTTGTAAGATTATTGAAGGAGATGTTGGTCATAAATTCAGAGTTAGAGAGTACTGGATTATGGGAGGCAATGAGGGAACCTACTTCTGATGTCATCA
AAAAAAAAGATCGGAAAGAGTTCCCTGGGGAAAGAGATTGAGGTAGGAGTTTTCTGATGAGGGAGGCTTGT

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.968125
Expected error %
0.504
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0017C15
Clone
Clone name
hba-17c15
LE_HBa0017C15
C01HBa0017C15
P017C15
Clone type
BAC
Contamination
none
Estimated length
71,322
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found