Clone Read LE_HBa0017C15_T7_130290

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0017C15_T7_130290
Primer
T7
ID from Seq. Facility
LE_HBa_017_C15-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
806 trimmed for vector and quality, 999 raw
Genbank Accession
Sequence
>LE_HBa0017C15_T7_130290 (raw untrimmed)
TAACTTGGGCCCGGGGGGATCTCTAGAGTCGACCTGCAGGCATGCAAGCTTGTATATATATTTAATTGAATACAATTGGAGAGAGAGGTTGTTATAAAAA
CAATATATTGTTGTTATTGTTTTTTTTCTTTTGTAATATTTTTGAACTAATTCTATCTTTTCATAAATGAGTTAAATTTTTTACTTATTCCATAATTCTT
CCATAAATAATTTTTTTTTATTTGGCTATACTTGATATCTATAAATTTTAATTTTAATTGTGCATCACTAGATATTGAAATTGTCCAAAGAATGTAACAA
ATAAACACGTTCAAATATTTTAGGTATTATAAGATTGAAATGCAAACACTTTTACATGGAATGGATAAAAATAAGGGATAATTGTATATAATAGCAAACT
AATAACCTAAAATAAATGGAGTAACTACGGTTTAATTTAATTATGCTCCATAGCAAACGTTCGCCAAAGTTTGTCAGTCGCCTCTCTCCCAAAAATCTCG
TTCGCCACTCTCCCTCTGCTCGCCTCTCTCGCTTTATACACAGAAGTGTATAAATTGTGTTTCTGTTTTGTATGAAGCGGGAAAAAATTGTATATACACA
TGCAAAAACATATATTTTCGTGCTATACACTTAATTATACAATTTACAAACATTTTACTTCAATTCAATTGTAGACAAATGCAAATTTTATACAAATTAT
TGCAGCGAAAAAGGCCAGCGAATTATACAATTGTAGTGAAATACAATTTTCTCTCGCTTTATACAACAGAAGTGTATATATTGTGTTTCTGTTTTTGTAT
AAAGCGAGAGAAAAACATATATCTTTTTTCCATACACTTAAAATTATGCAATATACATACCTTTTACTTTGTTTCCATTTGAAGCAAAAAAAATTTTATA
ATGTCTCTTCCTGTTATCTCAACAATCATAAAAATTAAGGAAAATTTAATCCAAAATTACCATCCAAAAAAAGCTTTTAGTTTTAGATTTTCTTTCTTG
>LE_HBa0017C15_T7_130290 (trimmed for quality and cloning vector)
AGCTTGTATATATATTTAATTGAATACAATTGGAGAGAGAGGTTGTTATAAAAACAATATATTGTTGTTATTGTTTTTTTTCTTTTGTAATATTTTTGAA
CTAATTCTATCTTTTCATAAATGAGTTAAATTTTTTACTTATTCCATAATTCTTCCATAAATAATTTTTTTTTATTTGGCTATACTTGATATCTATAAAT
TTTAATTTTAATTGTGCATCACTAGATATTGAAATTGTCCAAAGAATGTAACAAATAAACACGTTCAAATATTTTAGGTATTATAAGATTGAAATGCAAA
CACTTTTACATGGAATGGATAAAAATAAGGGATAATTGTATATAATAGCAAACTAATAACCTAAAATAAATGGAGTAACTACGGTTTAATTTAATTATGC
TCCATAGCAAACGTTCGCCAAAGTTTGTCAGTCGCCTCTCTCCCAAAAATCTCGTTCGCCACTCTCCCTCTGCTCGCCTCTCTCGCTTTATACACAGAAG
TGTATAAATTGTGTTTCTGTTTTGTATGAAGCGGGAAAAAATTGTATATACACATGCAAAAACATATATTTTCGTGCTATACACTTAATTATACAATTTA
CAAACATTTTACTTCAATTCAATTGTAGACAAATGCAAATTTTATACAAATTATTGCAGCGAAAAAGGCCAGCGAATTATACAATTGTAGTGAAATACAA
TTTTCTCTCGCTTTATACAACAGAAGTGTATATATTGTGTTTCTGTTTTTGTATAAAGCGAGAGAAAAACATATATCTTTTTTCCATACACTTAAAATTA
TGCAAT

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.915731
Expected error %
0.8702
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0017C15
Clone
Clone name
hba-17c15
LE_HBa0017C15
C01HBa0017C15
P017C15
Clone type
BAC
Contamination
none
Estimated length
71,322
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found