Clone Read LE_HBa0017E02_T7_130360

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0017E02_T7_130360
Primer
T7
ID from Seq. Facility
LE_HBa_017_E02-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
706 trimmed for vector and quality, 948 raw
Sequence
>LE_HBa0017E02_T7_130360 (raw untrimmed)
AGGAACTGGTTCCGGGGGGACCTCTAGAGTCGACCTGCAGGCATGCAAGCTTCTGTTCGATTGGTGAGACGGGCCAAAGAGAGGATTAAGTGTTCCCTAA
CTGAGATCTTAAAGACCTAAAGGAACTAAAAGTGACTAAGAAGAACCAGAAGAAGTCACTAATAAAACAAATACAACAAATGAAGACCTGGAAAAGTTCA
TATCATTGAAATAGAGAACTACTAATTCACAGTATGTTGTAGATCAAAGTATTTGCTTATATGAGCTGAAGGATTTTATATCTTTTAAGGAAGTATTCCT
AGATTTTGCTCTTGCTGACATTAAAGGAAACACAGCTTTCTTTATGGTCTGACATTCAAAGAGAAACAACTAGAAGAGACCTTAGTAGAATTGTCCACAT
GTACGGGAAAGCGCTTGCAAGCAATGTTGTGTTTCCACCCGCAGTGAGGTGCAAGCTGCACAGTCATACTGTTAGAAAACCAAAGAGTTTGAGTAAGGAC
GGAATGACAGGTGCAAGAACTCACATGTTAAAACAATGACTTCAAAATGAAGAGCTAACTCTCCATTCAGAACATGCGGCTAGAAGGTAGACTGAAATTA
GCCTGAAAAAGTAAGCTGCAGTCGACCCTGCGTCTCGGAATTATCACGGATGCAAGACCAGTTCACACACTTGATCACATAAAAGCAAAGATACCTCAAA
AGACCTTCTTGCCAGTTTATGTTAGGATAATATAATCACTAAATAATCACTTGCATCGACGCTAGTCAATTTACTTACAGCAGAACAATACCCTGCAAGC
AGGGATTTGTTCATCTTTCGATTGCAATTAGGGAAAGGCGGAATGTTTATTTGGTTCGGTATAGCCGTTCTCTTACTTACCACCAAATGACCATTACTGG
AAAAGGGCTTGTAAATTTCAAGGGTGAATAAAACAAAGTTTGACCGGT
>LE_HBa0017E02_T7_130360 (trimmed for quality and cloning vector)
AGCTTCTGTTCGATTGGTGAGACGGGCCAAAGAGAGGATTAAGTGTTCCCTAACTGAGATCTTAAAGACCTAAAGGAACTAAAAGTGACTAAGAAGAACC
AGAAGAAGTCACTAATAAAACAAATACAACAAATGAAGACCTGGAAAAGTTCATATCATTGAAATAGAGAACTACTAATTCACAGTATGTTGTAGATCAA
AGTATTTGCTTATATGAGCTGAAGGATTTTATATCTTTTAAGGAAGTATTCCTAGATTTTGCTCTTGCTGACATTAAAGGAAACACAGCTTTCTTTATGG
TCTGACATTCAAAGAGAAACAACTAGAAGAGACCTTAGTAGAATTGTCCACATGTACGGGAAAGCGCTTGCAAGCAATGTTGTGTTTCCACCCGCAGTGA
GGTGCAAGCTGCACAGTCATACTGTTAGAAAACCAAAGAGTTTGAGTAAGGACGGAATGACAGGTGCAAGAACTCACATGTTAAAACAATGACTTCAAAA
TGAAGAGCTAACTCTCCATTCAGAACATGCGGCTAGAAGGTAGACTGAAATTAGCCTGAAAAAGTAAGCTGCAGTCGACCCTGCGTCTCGGAATTATCAC
GGATGCAAGACCAGTTCACACACTTGATCACATAAAAGCAAAGATACCTCAAAAGACCTTCTTGCCAGTTTATGTTAGGATAATATAATCACTAAATAAT
CACTTG

This is probably not a useful sequence.

Problems:
  • High predicted error rate
Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.956677
Expected error %
4.2899
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0017E02
Clone
Clone name
hba-17e2
LE_HBa0017E02
P017E02
Clone type
BAC
Contamination
none
Estimated length
61,941
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found