Clone Read LE_HBa0017E22_T7_130400

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0017E22_T7_130400
Primer
T7
ID from Seq. Facility
LE_HBa_017_E22-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
565 trimmed for vector and quality, 925 raw
Sequence
>LE_HBa0017E22_T7_130400 (raw untrimmed)
GGGGACGGGGTCCGCGGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTTGTGTCCTCTTTGTGTGCCGTCTTCTCTCGATTGTTCTCTTTCCCT
CTCCTTGTTCTTTGTATTTTTCTTATTCAAACATCTCTTTCTTTTACCCTAATTAACATATAATTAAGTATAAAAGATGATGAATTAACCCATTAATTAA
TTCGAGGTTATCTCGTTTAAGCCCTCAAGTAGTTAAATTATTAACAGTTGTTGAGTGCCCATTTTAGACCATCTCCGATAGAAATTAATTCATGAGCTTG
TTAAATTTTCCGAGCTATTAAAAATGATTAGTTTTAGCAATTTTTAACATGAAAAAATAAAGGTTGTGTTATTTGGTGTATTTTTGTCTTTTCTTAAAAA
TTTTAAATAATATATATATTTTACTTAATTACGTATATTATAAGTATATTTATATGATTATTGTGAAAAAGAACTTATAAACATTTTAATTTGATGAAAT
ATTCTATTTAGCTAAGGAATTTTAGGAGATGGTTATATTTCGATCCAATATTTTACAAGTTTATTAATTGCATTACTGGATTAAAGGAGCTCGTTGAATA
ATTGACATAAATTATATTTATTTAGTGTGTAGCCGACTTTGATAACCTCATCCCATTTGGCTATTTTATCTATGTTCACCTATTCATGAATTCCACCAAC
TGATCTTATTTTTGGGGCCCATCTTTAATCCCTTTAATTTCCAAGCCTATTTGGTTTGCTACTTGACACAACACCAAGCTTAATAATTACCTGCCCCTCT
CATTCCTGGAGGCTCCATTTGTTTTCAACCATGGGACGAAAGACTGGCTCTTTCTTTTCAATTTATTACACCTTATCCCTTTTTCCTTTTTCTTCAAAAT
AACCTTTTAAATTCCATAGTCAATA
>LE_HBa0017E22_T7_130400 (trimmed for quality and cloning vector)
AGCTTTGTGTCCTCTTTGTGTGCCGTCTTCTCTCGATTGTTCTCTTTCCCTCTCCTTGTTCTTTGTATTTTTCTTATTCAAACATCTCTTTCTTTTACCC
TAATTAACATATAATTAAGTATAAAAGATGATGAATTAACCCATTAATTAATTCGAGGTTATCTCGTTTAAGCCCTCAAGTAGTTAAATTATTAACAGTT
GTTGAGTGCCCATTTTAGACCATCTCCGATAGAAATTAATTCATGAGCTTGTTAAATTTTCCGAGCTATTAAAAATGATTAGTTTTAGCAATTTTTAACA
TGAAAAAATAAAGGTTGTGTTATTTGGTGTATTTTTGTCTTTTCTTAAAAATTTTAAATAATATATATATTTTACTTAATTACGTATATTATAAGTATAT
TTATATGATTATTGTGAAAAAGAACTTATAAACATTTTAATTTGATGAAATATTCTATTTAGCTAAGGAATTTTAGGAGATGGTTATATTTCGATCCAAT
ATTTTACAAGTTTATTAATTGCATTACTGGATTAAAGGAGCTCGTTGAATAATTGACATAAATTA

This is probably not a useful sequence.

Problems:
  • High predicted error rate
Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.899048
Expected error %
4.1622
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0017E22
Clone
Clone name
hba-17e22
LE_HBa0017E22
P017E22
Clone type
BAC
Contamination
none
Estimated length
118,676
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found