Clone Read LE_HBa0017I23_SP6_130593

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0017I23_SP6_130593
Primer
SP6
ID from Seq. Facility
LE_HBa_017_I23-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
695 trimmed for vector and quality, 892 raw
Genbank Accession
Sequence
>LE_HBa0017I23_SP6_130593 (raw untrimmed)
TTATTTATCACTTTATTATGCCCCAAAATCTTGGAAGTCATCACACCAAGAACATCTATCCTCAAACTTCTAAATCTAAGAGTATTTAAGAAGCTAAAAT
AAGTAAAAGAGATGGTCCATGTCCGAACTTCAAGACATCAAGACGTGAAGGAGACAATCCAGTCCGATCTAGGAATAATAGCTCACCCTGAAATCTGATA
TGTTGAAGACTGACTAGAGTTGAGGACGAGTCGAAGTCGATGGCATGCTTGCTGCACTCCACAAATAACAAAGAAGAAAATTACAAGTAGGGGTCAGTAC
AAGGAACACGTACTGAGTAGGTATCATCGGCCAACTCAAAATAGAAAGCAATATATACTGAATAATAGTATAAAATCAACCACAATACTTAACCGGTGAC
AACAACAAGTACAAGAACCATTGGCAACAACACCAAGCACGCCCATGAGGACTCAAGCCTCCACACCATACTCATTTGGGAAATAGGTTCTTCGAATTGA
GTATATTAACATAAATCAAGATTACTTCTCTTTATTATTATCGTGTCGGAACGTGACACTCGATCCCCTAATACTACGTGTCGGAACGTGACACCCGATC
CCCTAATACTACGTGTCGGAACGTGACACCCGATCCATTTATCTCATTATTTTAGTTTCATCAAGCCTCTTTTATGTCAAGGCGTCATCTTAATAGAGAG
GGCTAAGATTGAAGATTCCACAATCACAACATAACAACACACAATCCAGCATATAGAAGACTTTACAATACCCCCCAATACATATCAATCGCTATTTAGA
GTTTATCTATCCCATAGAAATAAACCATAACCTACTCCCCCGAAAAATCGTGATCAAGCAAGTTACTTCCCAATGCCTTTGCTTTCCTCTCG
>LE_HBa0017I23_SP6_130593 (trimmed for quality and cloning vector)
GAAGTCATCACACCAAGAACATCTATCCTCAAACTTCTAAATCTAAGAGTATTTAAGAAGCTAAAATAAGTAAAAGAGATGGTCCATGTCCGAACTTCAA
GACATCAAGACGTGAAGGAGACAATCCAGTCCGATCTAGGAATAATAGCTCACCCTGAAATCTGATATGTTGAAGACTGACTAGAGTTGAGGACGAGTCG
AAGTCGATGGCATGCTTGCTGCACTCCACAAATAACAAAGAAGAAAATTACAAGTAGGGGTCAGTACAAGGAACACGTACTGAGTAGGTATCATCGGCCA
ACTCAAAATAGAAAGCAATATATACTGAATAATAGTATAAAATCAACCACAATACTTAACCGGTGACAACAACAAGTACAAGAACCATTGGCAACAACAC
CAAGCACGCCCATGAGGACTCAAGCCTCCACACCATACTCATTTGGGAAATAGGTTCTTCGAATTGAGTATATTAACATAAATCAAGATTACTTCTCTTT
ATTATTATCGTGTCGGAACGTGACACTCGATCCCCTAATACTACGTGTCGGAACGTGACACCCGATCCCCTAATACTACGTGTCGGAACGTGACACCCGA
TCCATTTATCTCATTATTTTAGTTTCATCAAGCCTCTTTTATGTCAAGGCGTCATCTTAATAGAGAGGGCTAAGATTGAAGATTCCACAATCACA

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.968998
Expected error %
0.2144
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0017I23
Clone
Clone name
hba-17i23
LE_HBa0017I23
C08HBa0017I23
P017I23
Clone type
BAC
Contamination
none
Estimated length
93,830
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found