Notice: SGN will be briefly unavailable for maintenance. Apologies.

Clone Read LE_HBa0017N03_SP6_130793

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0017N03_SP6_130793
Primer
SP6
ID from Seq. Facility
LE_HBa_017_N03-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
613 trimmed for vector and quality, 922 raw
Sequence
>LE_HBa0017N03_SP6_130793 (raw untrimmed)
AAAAAGAAGTCCAGGAGAACAGAAGCAGCTTCTCTAATAGCCCCGTTGAATAGGCGGGCGAACGCTTTTTGAAAAAGTCTTTTTTTTCTTGTAAATGCAT
TTTTTTCTATTTAGAGAGAGGGGGCTTCAAGTTCTTAGGAAGAGCCGTACGAGACAGCTCACGTACGGTTCGGGAGCCGAGCCCCTGCGCAGGGGCTTAG
GTCAACACTTATATAATAGCCAGTCATCAATTGGAGGCGGGCAAGATGGTGATGAATTGCGATTGGTCTAAACCTTCAACTAGCGACTTATGGCGGCCTG
CCCAGAATGCCCATACAGACTAAGACCTTATTCACACAGCGAAGAAAGGCCGAGTGGAAGGGGGCAGTCAGCTGGCTGCTTCTTTGCCATGCGCTTTGCT
TCGCTTTATTTTTTAGAAGAAAGAGACCAAATGAGAGTGAAAGGCAAGGGCAAGCGATAGAAAAGTCCCTCGCGCGAACTACTACTACTAGAAAATGGTG
AGACCATTAGTGAAAGAAGGACCAAACCAAGGAGGATCCTATCCTAAAGGAGAAGGAGGAGTAGGAGGAGTCAGTTTTCTTTGAAGATCGAGGAACGTAG
TGTCGGACAATTATGCCATTCGGAAGAAGTCTTCTACAGAAGAAAAGCCTGTTACGAGTAAGTGGAGAGGAAAGATCTACAGACATTCTTATCTCATTCC
GTTCCAGTGGCTCAACCAGTAACCAATGGCGAAAAGCTCAAAATCCATGGTCTCCCGGCAGAACCCTATCTCCCCCACGATGTTTCGGAACCGGAAAAAG
GATGCGGTTTTCGCACAGTTTGGTCATAATGCACGTCCCACTTGTATATCGTATTTGGCCGAGCACACACGGACAGGTTGGAGTTCTTACTTCATGGGAC
TCCTGGACCAAATCTGCTTTTT
>LE_HBa0017N03_SP6_130793 (trimmed for quality and cloning vector)
AGCAGCTTCTCTAATAGCCCCGTTGAATAGGCGGGCGAACGCTTTTTGAAAAAGTCTTTTTTTTCTTGTAAATGCATTTTTTTCTATTTAGAGAGAGGGG
GCTTCAAGTTCTTAGGAAGAGCCGTACGAGACAGCTCACGTACGGTTCGGGAGCCGAGCCCCTGCGCAGGGGCTTAGGTCAACACTTATATAATAGCCAG
TCATCAATTGGAGGCGGGCAAGATGGTGATGAATTGCGATTGGTCTAAACCTTCAACTAGCGACTTATGGCGGCCTGCCCAGAATGCCCATACAGACTAA
GACCTTATTCACACAGCGAAGAAAGGCCGAGTGGAAGGGGGCAGTCAGCTGGCTGCTTCTTTGCCATGCGCTTTGCTTCGCTTTATTTTTTAGAAGAAAG
AGACCAAATGAGAGTGAAAGGCAAGGGCAAGCGATAGAAAAGTCCCTCGCGCGAACTACTACTACTAGAAAATGGTGAGACCATTAGTGAAAGAAGGACC
AAACCAAGGAGGATCCTATCCTAAAGGAGAAGGAGGAGTAGGAGGAGTCAGTTTTCTTTGAAGATCGAGGAACGTAGTGTCGGACAATTATGCCATTCGG
AAGAAGTCTTCTA

This is probably not a useful sequence.

Problems:
  • Probable foreign DNA contamination
Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.978662
Expected error %
0.3127
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
dbj|BAC19886.1| Score 83 E Value 4e-15 Identity 24.60% Align. Length 182bp (29.69%) Frame 2
Ribosomal protein L2 [Oryza sativa (japonica cultivar-group)] pir||T03019 probable ribosomal protein L2 [imported] - rice mitochondrion dbj|BAA11350.1| ribosomal protein L2 [Oryza sativa (japonica cultivar-group)]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
sp|P92812|RM02_ORYSA Score 83 E Value 4e-15 Identity 24.60% Align. Length 182bp (29.69%) Frame 2
Mitochondrial 60S ribosomal protein L2
Arabidopsis thaliana Mitochondria (screening/organelle/ATH1_mitochondria)NCBI BLAST
mitochondria Score 272 E Value 3e-74 Identity 95.20% Align. Length 249bp (40.62%) Frame 3
No sequence description found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0017N03
Clone
Clone name
hba-17n3
LE_HBa0017N03
C02HBa0017N03
P017N03
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found