Clone Read LE_HBa0017N03_T7_130794

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0017N03_T7_130794
Primer
T7
ID from Seq. Facility
LE_HBa_017_N03-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
816 trimmed for vector and quality, 966 raw
Genbank Accession
Sequence
>LE_HBa0017N03_T7_130794 (raw untrimmed)
GTGGGCTGGGTCCCGGGGGATCTCTAGAGTCGACCTGCAGGCATGCAAGCTTTGAAGTCCCTACTTTATTTAGATTTATGGGATATTTGAAGAAGCGCAG
GTTTGGAACCCTATACCTATACAAGGGGCTGGTCTCGATCTCGCTTGGTGGTACCCCTCTCGATGATTGTTGACTCAACATTGATTTCGTGCTTGAGTTG
GAGGGCTCTCCCTCCATCCATCGAGTCAAGTAATTCGCTATCGGAAATTTCTCCGCCGCCTATCTCATGCCATGCTTCTTCTTTCTCCGAATCGGTTCCT
AGTGTCAGTCAATCAAGATTCGCCATCAAGAGAGGGAAGAGCCTTGACTTTAGGTTAGGCCGGTCTCATCATTCACGCAATTCCCCCGTCCATCGATTGA
TCACGCGAGTACGCATCCAGTCAGCGCATAGCGAATGAAAAAAGCGTTCATCCTGGATTCTCTTCCTCAAGAAAAATGTCTATCAATTGATCCCTACGGT
CAAAGTCTCCACTTTTCACGCCCCTCTACTAAGAGATGCACCATGTTGATAGGAATCGGCAAAGACCTTCTTGTACACGTCCTCGAGGGCAGCATTCATG
GCAATCATCACTACTTTCTCCCGAGGGCATGGTATGGCTTTGTTCTTGGTCTTGTTTAATAGATGTCGAGTGCCGCTTTTCCCCGTCCGAGAATCTCCAT
CTGCTCTAAGTGGGCGCGAGCTAGAATCCTTATGTCAGCTTGGTTGTTCAAAAGACTGTCTCTTTACCCCTTGCATCTTCATCTTTTCGAAAGCCCAGAC
CATTCTTCTGGATCTGCATTAGTCCTATTTCAGGTGCAAAGCCTCTTCAATAAAGACCTCTTTTTTTGAATTCTCCCCCCTTTCTCATTTTGTTGATTGA
AAGAAATAAACCCCTTCCCATGAGTAAAGAAAGGGTTTGCTTCAATGATTCCGGGCGTTGGGGGCC
>LE_HBa0017N03_T7_130794 (trimmed for quality and cloning vector)
AGCTTTGAAGTCCCTACTTTATTTAGATTTATGGGATATTTGAAGAAGCGCAGGTTTGGAACCCTATACCTATACAAGGGGCTGGTCTCGATCTCGCTTG
GTGGTACCCCTCTCGATGATTGTTGACTCAACATTGATTTCGTGCTTGAGTTGGAGGGCTCTCCCTCCATCCATCGAGTCAAGTAATTCGCTATCGGAAA
TTTCTCCGCCGCCTATCTCATGCCATGCTTCTTCTTTCTCCGAATCGGTTCCTAGTGTCAGTCAATCAAGATTCGCCATCAAGAGAGGGAAGAGCCTTGA
CTTTAGGTTAGGCCGGTCTCATCATTCACGCAATTCCCCCGTCCATCGATTGATCACGCGAGTACGCATCCAGTCAGCGCATAGCGAATGAAAAAAGCGT
TCATCCTGGATTCTCTTCCTCAAGAAAAATGTCTATCAATTGATCCCTACGGTCAAAGTCTCCACTTTTCACGCCCCTCTACTAAGAGATGCACCATGTT
GATAGGAATCGGCAAAGACCTTCTTGTACACGTCCTCGAGGGCAGCATTCATGGCAATCATCACTACTTTCTCCCGAGGGCATGGTATGGCTTTGTTCTT
GGTCTTGTTTAATAGATGTCGAGTGCCGCTTTTCCCCGTCCGAGAATCTCCATCTGCTCTAAGTGGGCGCGAGCTAGAATCCTTATGTCAGCTTGGTTGT
TCAAAAGACTGTCTCTTTACCCCTTGCATCTTCATCTTTTCGAAAGCCCAGACCATTCTTCTGGATCTGCATTAGTCCTATTTCAGGTGCAAAGCCTCTT
CAATAAAGACCTCTTT

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.978518
Expected error %
0.455
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
dbj|BAD66768.1| Score 104 E Value 3e-21 Identity 57.30% Align. Length 448bp (54.90%) Frame 3
orf152 [Beta vulgaris subsp. vulgaris] dbj|BAD66724.1| orf152 [Beta vulgaris subsp. vulgaris] dbj|BAA99317.1| orf152 [Beta vulgaris subsp. vulgaris] ref|NP_064005.1| hypothetical protein [Beta vulgaris subsp. vulgaris]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0017N03
Clone
Clone name
hba-17n3
LE_HBa0017N03
C02HBa0017N03
P017N03
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found