Clone Read LE_HBa0018A19_SP6_130969

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0018A19_SP6_130969
Primer
SP6
ID from Seq. Facility
LE_HBa_018_A19-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
525 trimmed for vector and quality, 902 raw
Sequence
>LE_HBa0018A19_SP6_130969 (raw untrimmed)
GAAATAAAAAAAAGGGACGCTTTTTTTCTAATCAAAAGAAAAAAAAATCGAAGTCATTTGGTCTCTATGGAATGGAGATAACAAAAATCAAAATCCAGCA
AGATTTAGCCATGATCTTTCAATGCAACAAAATCCAGCAGGGTCCTGAGTACCTTCCGGCTCTAAATCCCTGGTTCTCAATCACTAGGGACTTAGTGTGC
TTCTATTTCAGGACTTGACATTGCTGTTGCTTCCAGGCAGGCAGGCATCTTACTGGGGAACGCCCACATCATCAGTCTTTTCCAGGCATAACACAACAAA
AAAGTATTCAGTGGCCAAACTAGCACTTTTATCTGTTAACGTTCTTGGTATAGGAACTAACTTCAACCAGTCATTTAAATCTCGAAACAAATTACAGGTG
ATAATTGTGAAGCCCATGACAGCCAAAAGAGCATATACGAAGTTTAATTTCGGGTATGCTACACTTGAAAGGCTGGCCCTTGTACTTCACAGCAAAGGTT
GCTACCCGTAGCATCACTCCCATCATGTATGAATGGATCGACAAAAATGGGTTTGCTACCTGTAGCATCACTACCATCATGTAAGAATGAATCGACAGAA
ATGGGTACAAATAGAGTCTGGCTGAATTCAGCAGGGAGGAAGAAGGACCCAGGACCAAGAAAATTTTAGGATGTGGTCTCCTTAACTGACATGTATTGGA
AGGGGAGGAAGCTGTTTTAAACAAAAAAAAAACCAAAACACGTAAATTAGATTTTAACCGACCATTGGTTTCGAGATTCTTCTTCCAGAAACCTCCAATT
AAAACTTGTTAAATTTAGGTGCATCTTTTGCCCTTTCAAAGGATTCCCTCCTCTTCAAAAGGCGCTTTTTTTCTTTCTTTGAAATTGGCTTCCCTCAATG
TC
>LE_HBa0018A19_SP6_130969 (trimmed for quality and cloning vector)
AAAAAAAAATCGAAGTCATTTGGTCTCTATGGAATGGAGATAACAAAAATCAAAATCCAGCAAGATTTAGCCATGATCTTTCAATGCAACAAAATCCAGC
AGGGTCCTGAGTACCTTCCGGCTCTAAATCCCTGGTTCTCAATCACTAGGGACTTAGTGTGCTTCTATTTCAGGACTTGACATTGCTGTTGCTTCCAGGC
AGGCAGGCATCTTACTGGGGAACGCCCACATCATCAGTCTTTTCCAGGCATAACACAACAAAAAAGTATTCAGTGGCCAAACTAGCACTTTTATCTGTTA
ACGTTCTTGGTATAGGAACTAACTTCAACCAGTCATTTAAATCTCGAAACAAATTACAGGTGATAATTGTGAAGCCCATGACAGCCAAAAGAGCATATAC
GAAGTTTAATTTCGGGTATGCTACACTTGAAAGGCTGGCCCTTGTACTTCACAGCAAAGGTTGCTACCCGTAGCATCACTCCCATCATGTATGAATGGAT
CGACAAAAATGGGTTTGCTACCTGT

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.978855
Expected error %
0.3994
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At5g23630.1 Score 50 E Value 9e-13 Identity 50.90% Align. Length 255bp (48.57%) Frame 3
68418.m02771 ATPase E1-E2 type family protein / haloacid dehalogenase-like hydrolase familiy protein similar to SP|O14072 Cation-transporting ATPase 4 (EC 3.6.3.-) {Schizosaccharomyces pombe}; contains InterPro accession IPR001757: ATPase, E1-E2 type; contains Pfam profile PF00702: haloacid dehalogenase-like hydrolase
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
dbj|BAA97238.1| Score 50 E Value 4e-11 Identity 50.90% Align. Length 255bp (48.57%) Frame 3
cation-transporting ATPase [Arabidopsis thaliana] ref|NP_197752.1| ATPase E1-E2 type family protein / haloacid dehalogenase-like hydrolase familiy protein [Arabidopsis thaliana] sp|Q9LT02|ATX1_ARATH Potential cation-transporting ATPase
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT85208.1| Score 44 E Value 5e-16 Identity 52.60% Align. Length 292bp (55.62%) Frame 2
unknown protein [Oryza sativa (japonica cultivar-group)]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0018A19
Clone
Clone name
hba-18a19
LE_HBa0018A19
P018A19
Clone type
BAC
Contamination
none
Estimated length
103,142
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found