Clone Read LE_HBa0018A19_T7_130970

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0018A19_T7_130970
Primer
T7
ID from Seq. Facility
LE_HBa_018_A19-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
566 trimmed for vector and quality, 933 raw
Sequence
>LE_HBa0018A19_T7_130970 (raw untrimmed)
GGATCCGCGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTCAGGGCCAGTATTCAGATGCAAATATCACTCATGTTGATATTTTTTCCATCAAGT
CTAATCTGATAGCAAATTATTCCCGAAATGGTAAGTTACTAAGTTTCTTTACTCGCAAATGCCAAAAAGATGATTGCTTTATGCAGTTTCTTTGTGATTT
TGGAAGTCATGAGATATAAAGTGAAATTGTTCCACCAATATCATATGAACTTTATTGAGAAGAACTGCAGCGCGTCCACTGTGTTCTTCTTCTGGAAGGC
CATGAGTGGAGGAGATATGGTGCCTTTGCTTTCTTGATTTGGCTTTAGAACTTCTTCTGATAAACACAGCTGAGAAACATACTTTTGCCATCATGATAAC
TTGATTATACTTCAACTTAAAGGAAACCAAAGCAGGACGAGAGTTTCCACAAAGTGCACTCTCATTAAATTGTAGAAGAAAATAATTAATATAACACTTG
GTACTTTGCATTTACACCTTGCAGGATTTGAGCAGCTATTAATGGCTTGCTGTGGATATGGAGGACCTCCACTCAACTATGACAGCAGGATTGCCTGTGG
TCATACAAATGTGTTGTATGGAAATCACTTTACTGCCAATAGCATGCAATGAACAGTCTTTGATTTTTTTAATTTTGGATGGAAATTTCTTTCACCAAAA
CTCCCTTACCCTCTTTTGCTCCTTCCCAATTTCTACCCTGGGAAAGTTACCCTTGTTCCGACCTTTCCAATACAAAGTTGCCCTTTCTTTCTTCAAACTC
AAACTTTCTGCTGGTAAATAGTTGGCCTCTTCTCATCTGCGATGGACATCCCGTGACGAATATATTTCTGACTCCAGGATTTTTACTTTTAACGTAATTT
TCTAACTACGTCCCCCTTGGGCATTTGTCTTGT
>LE_HBa0018A19_T7_130970 (trimmed for quality and cloning vector)
AGCTTCAGGGCCAGTATTCAGATGCAAATATCACTCATGTTGATATTTTTTCCATCAAGTCTAATCTGATAGCAAATTATTCCCGAAATGGTAAGTTACT
AAGTTTCTTTACTCGCAAATGCCAAAAAGATGATTGCTTTATGCAGTTTCTTTGTGATTTTGGAAGTCATGAGATATAAAGTGAAATTGTTCCACCAATA
TCATATGAACTTTATTGAGAAGAACTGCAGCGCGTCCACTGTGTTCTTCTTCTGGAAGGCCATGAGTGGAGGAGATATGGTGCCTTTGCTTTCTTGATTT
GGCTTTAGAACTTCTTCTGATAAACACAGCTGAGAAACATACTTTTGCCATCATGATAACTTGATTATACTTCAACTTAAAGGAAACCAAAGCAGGACGA
GAGTTTCCACAAAGTGCACTCTCATTAAATTGTAGAAGAAAATAATTAATATAACACTTGGTACTTTGCATTTACACCTTGCAGGATTTGAGCAGCTATT
AATGGCTTGCTGTGGATATGGAGGACCTCCACTCAACTATGACAGCAGGATTGCCTGTGGTCATAC

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.957974
Expected error %
0.4172
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0018A19
Clone
Clone name
hba-18a19
LE_HBa0018A19
P018A19
Clone type
BAC
Contamination
none
Estimated length
103,142
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found