Clone Read LE_HBa0018B15_SP6_131009

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0018B15_SP6_131009
Primer
SP6
ID from Seq. Facility
LE_HBa_018_B15-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
621 trimmed for vector and quality, 873 raw
Sequence
>LE_HBa0018B15_SP6_131009 (raw untrimmed)
GGTTTTATTCCCCACATTATATCTAAAACTACTGGTCTAAACCTCTCTATTAATGATGTTCTATCATGCTGAATTTCCTGGAATCTTTACTGTTATGAAG
GGATAAAATCCAGAAAACTTTTGTAAAACTCAGTAAATCTTGATACTGAAGTTTTACCAACAAAAAAAAATTATTCTTATTTGTCGAAAAAAATTCCGAT
TGCGTTCCTTTCTCACCGAATCAAAACTCCTCAACAGACAGAAAATATAGGAAAGCTAACATGGCAATTCCATAACTTGTAATCATGCATATTTGTTACT
CCTTAATATATATACATATAAACATAAAACAGGTAGCATACCCAAAAATTTATATATGTTTCTATCACAAAAGCAACAGATAAATCCCCAAAGATGATAA
ATCTAACTAATGTGATCTAGAGCTTTGAACAACTAAAACAGGTAGCTTTAGACTTAACGTGATACAAAAAGTAGCAAAGACACAAAGTAGTCAACTATAA
ACAGCAATATATTAAGTAGCATACTTTAGCTAGTTAGACCCCGTAGTCGAGCTTATCCTCGATTAACCAATTGGAGATCGTGAGTCTAATTTAGAGAGAA
TGGCTACCATCAAAGGAGCTACAAGTGTTAGCACCAGCTCAAATAGTGGTGCACATTCTTATCCAACTTTTAAGGGCTCCTCTCCACATAAAAAAGATAC
TAGTTCTAGAAACAAGGTATGAAAACTCACACACCAAAACATAAATTAACTTTTCATTAGCATCTTTCCCCTTCCCAGTGGTGGGAATCCTAAAAACAAA
ATATTCCCTCATATTTTTCCAAATTTTTCCACCCCCGGAACTAACAACCCTTCCTTTAATTATTTTTTACCAA
>LE_HBa0018B15_SP6_131009 (trimmed for quality and cloning vector)
TATTAATGATGTTCTATCATGCTGAATTTCCTGGAATCTTTACTGTTATGAAGGGATAAAATCCAGAAAACTTTTGTAAAACTCAGTAAATCTTGATACT
GAAGTTTTACCAACAAAAAAAAATTATTCTTATTTGTCGAAAAAAATTCCGATTGCGTTCCTTTCTCACCGAATCAAAACTCCTCAACAGACAGAAAATA
TAGGAAAGCTAACATGGCAATTCCATAACTTGTAATCATGCATATTTGTTACTCCTTAATATATATACATATAAACATAAAACAGGTAGCATACCCAAAA
ATTTATATATGTTTCTATCACAAAAGCAACAGATAAATCCCCAAAGATGATAAATCTAACTAATGTGATCTAGAGCTTTGAACAACTAAAACAGGTAGCT
TTAGACTTAACGTGATACAAAAAGTAGCAAAGACACAAAGTAGTCAACTATAAACAGCAATATATTAAGTAGCATACTTTAGCTAGTTAGACCCCGTAGT
CGAGCTTATCCTCGATTAACCAATTGGAGATCGTGAGTCTAATTTAGAGAGAATGGCTACCATCAAAGGAGCTACAAGTGTTAGCACCAGCTCAAATAGT
GGTGCACATTCTTATCCAACT

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.944677
Expected error %
0.2324
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0018B15
Clone
Clone name
hba-18b15
LE_HBa0018B15
P018B15
Clone type
BAC
Contamination
none
Estimated length
117,254
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found