Clone Read LE_HBa0018B15_T7_131010

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0018B15_T7_131010
Primer
T7
ID from Seq. Facility
LE_HBa_018_B15-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
803 trimmed for vector and quality, 913 raw
Sequence
>LE_HBa0018B15_T7_131010 (raw untrimmed)
GTGTACCGGGGGAATCTCTAGAGTCGACCTGCAGGCATGCAAGCTTGACAAGGTTTGGGTGTTGTAGAGCCGAAATCATGCCTATCTCATTGACAAATTC
ACGATTTCCTTGCCTTGACTTGGAAGACAGCTGCTTAACAGCTATGATGGCACCATCGGCGAGTACACCCTACAGATAGCAATATTCACAACAATCATAT
TACAGACAGAAGAAGGATATGAGTTACTTCAATTATTACTACTCTATTTTTCCTATAAACATGACATCGAGGATAACCAGTAGGAAATATCACCAAAAAA
CCGCAAGCTGTCCTTATGCAAAATCAGTATGGATAGAGAATTGATACCTTGTAAACTGGTCCAAACCCTCCTTCACCAATTTTGTTGGCAGGATCAAAGT
TATTAGTAGCAGCTTTAATTTGTCTAAGTCTAAAATGACCTGTTTGTAAATCAAGGGCTCTGAGTTCTGTAAACGAGATGAACATTGCAAACGTCAGTAT
ATATAGATCTTCTAAAACATCTGTATGATGAAAAACAACTTTTAAAAGAATGAACATCTGTATGACGAAGACAGTTTAAGACGTCATGAGCATTTAATCG
TGTGCTAAGTATCTATGATACGACATGATGTCGATCCACCAACAGAACAATCATCTCAATGCCGGTCAATTACAGGGAGATAATTATTTGTATCTCACGG
CTAGAAATCTCGTAAATGATTCTGATTATCACAACAGAACTATCCGCCATATTATCAAAATATAAAGAGTGAATAAAGTCCTTTAAAATATGTATACCCT
ATTTCTTTCTTGGGTTATTTTTTTCCCCTCCCAAAAAATGCCTTTTCTTCCCCAGAAGCAAATTAAAAACTAAGCCAAAAAGCCCCTTCCATTGGAAAGC
CGGAGTTCCAAGT
>LE_HBa0018B15_T7_131010 (trimmed for quality and cloning vector)
AGCTTGACAAGGTTTGGGTGTTGTAGAGCCGAAATCATGCCTATCTCATTGACAAATTCACGATTTCCTTGCCTTGACTTGGAAGACAGCTGCTTAACAG
CTATGATGGCACCATCGGCGAGTACACCCTACAGATAGCAATATTCACAACAATCATATTACAGACAGAAGAAGGATATGAGTTACTTCAATTATTACTA
CTCTATTTTTCCTATAAACATGACATCGAGGATAACCAGTAGGAAATATCACCAAAAAACCGCAAGCTGTCCTTATGCAAAATCAGTATGGATAGAGAAT
TGATACCTTGTAAACTGGTCCAAACCCTCCTTCACCAATTTTGTTGGCAGGATCAAAGTTATTAGTAGCAGCTTTAATTTGTCTAAGTCTAAAATGACCT
GTTTGTAAATCAAGGGCTCTGAGTTCTGTAAACGAGATGAACATTGCAAACGTCAGTATATATAGATCTTCTAAAACATCTGTATGATGAAAAACAACTT
TTAAAAGAATGAACATCTGTATGACGAAGACAGTTTAAGACGTCATGAGCATTTAATCGTGTGCTAAGTATCTATGATACGACATGATGTCGATCCACCA
ACAGAACAATCATCTCAATGCCGGTCAATTACAGGGAGATAATTATTTGTATCTCACGGCTAGAAATCTCGTAAATGATTCTGATTATCACAACAGAACT
ATCCGCCATATTATCAAAATATAAAGAGTGAATAAAGTCCTTTAAAATATGTATACCCTATTTCTTTCTTGGGTTATTTTTTTCCCCTCCCAAAAAATGC
CTT

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.967279
Expected error %
1.2407
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At1g53430.1 Score 76 E Value 3e-14 Identity 90.50% Align. Length 423bp (52.68%) Frame 1
68414.m06056 leucine-rich repeat family protein / protein kinase family protein contains Pfam domains PF00560: Leucine Rich Repeat and PF00069: Protein kinase domain
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At1g53440.1 Score 76 E Value 3e-14 Identity 90.50% Align. Length 423bp (52.68%) Frame 1
68414.m06057 leucine-rich repeat family protein / protein kinase family protein contains Pfam domains PF00560: Leucine Rich Repeat and PF00069: Protein kinase domain
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAF78446.1| Score 76 E Value 1e-12 Identity 90.50% Align. Length 423bp (52.68%) Frame 1
Contains similarity to receptor-like serine/threonine kinase from Arabidopsis thaliana gb|AF024648 and contains multiple leucine rich PF|00560 repeats and protein kinase PF|00069 domain. ESTs gb|T04455, gb|N38129 come from this gene pir||C96574 hypothetical protein T3F20.25 [imported] - Arabidopsis thaliana
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
ref|NP_175749.1| Score 76 E Value 1e-12 Identity 90.50% Align. Length 423bp (52.68%) Frame 1
leucine-rich repeat family protein / protein kinase family protein [Arabidopsis thaliana]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0018B15
Clone
Clone name
hba-18b15
LE_HBa0018B15
P018B15
Clone type
BAC
Contamination
none
Estimated length
117,254
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found