Clone Read LE_HBa0018F22_SP6_131215

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0018F22_SP6_131215
Primer
SP6
ID from Seq. Facility
LE_HBa_018_F22-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
641 trimmed for vector and quality, 810 raw
Sequence
>LE_HBa0018F22_SP6_131215 (raw untrimmed)
CCAAATTTTTAAATCAAATCTAAGAAGTTTCAATTCTAATCGCATTAAACAGTGTTGGTCTACTAGGCTACATATGACAATTGCACGTTGTTCCTTTTGA
ACTATTAATATTCTCAAAGATCAATCAGAATATGTGTGGATTCTATAAAATACAACTTAGATACAAGTCATTACTATTAAGGAACAAGATTAAATAACTG
CCTCTCACGAGATTAAAATCCCTATCGATACACCAGGAAGGAGAAGGTGGGAAGGAAGCATCTATGATTTAGTCTTCAAACAAAAGACCTCATTACTGTT
TGACTTGGAACCTTCTAGTTTCAGATAAGAAAGATGAAAGATCCTTCACTTTCATGTGCTCTACTGTAGAGGGACCTATTACAGAAAGTTCCATACTCAA
ATATATTTCTCCTATAATATCCTGCGTTTACTGGTACTCCTTTCCCAGTCTCATGATCAGATCAGCATATTTTCTCGATCACTTTCTCATTCGAACCAGT
TTTGCAAGTCAATGTTACTGCTAAACTGAAAGAAGTTTTGGCCAATGATTGGTCAAATAACTAAAGTGATGAAAAACAGGGATGATTTATAGATAGTAAG
CTATAGAAACAAGGAAAACAACAAAAGTAAGATACTACATCAGACATCAGACATCAGCTCTCATTCTTAATTGGTCTAGAGGCACGACACATCCACTTAA
AACACTGCATCCAAAGAGAAACGATTTCCAAGGCCCATTATTTTGAGTGTTGACGAAACCAAACTCTACAACTAGACCAATGTTCACCCAAAAAGTTTGT
TTAATGAAAA
>LE_HBa0018F22_SP6_131215 (trimmed for quality and cloning vector)
AATCGCATTAAACAGTGTTGGTCTACTAGGCTACATATGACAATTGCACGTTGTTCCTTTTGAACTATTAATATTCTCAAAGATCAATCAGAATATGTGT
GGATTCTATAAAATACAACTTAGATACAAGTCATTACTATTAAGGAACAAGATTAAATAACTGCCTCTCACGAGATTAAAATCCCTATCGATACACCAGG
AAGGAGAAGGTGGGAAGGAAGCATCTATGATTTAGTCTTCAAACAAAAGACCTCATTACTGTTTGACTTGGAACCTTCTAGTTTCAGATAAGAAAGATGA
AAGATCCTTCACTTTCATGTGCTCTACTGTAGAGGGACCTATTACAGAAAGTTCCATACTCAAATATATTTCTCCTATAATATCCTGCGTTTACTGGTAC
TCCTTTCCCAGTCTCATGATCAGATCAGCATATTTTCTCGATCACTTTCTCATTCGAACCAGTTTTGCAAGTCAATGTTACTGCTAAACTGAAAGAAGTT
TTGGCCAATGATTGGTCAAATAACTAAAGTGATGAAAAACAGGGATGATTTATAGATAGTAAGCTATAGAAACAAGGAAAACAACAAAAGTAAGATACTA
CATCAGACATCAGACATCAGCTCTCATTCTTAATTGGTCTA

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.950498
Expected error %
0.1109
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0018F22
Clone
Clone name
hba-18f22
LE_HBa0018F22
P018F22
Clone type
BAC
Contamination
none
Estimated length
77,134
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found