Clone Read LE_HBa0018F22_T7_131216

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0018F22_T7_131216
Primer
T7
ID from Seq. Facility
LE_HBa_018_F22-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
674 trimmed for vector and quality, 912 raw
Sequence
>LE_HBa0018F22_T7_131216 (raw untrimmed)
TTGGTCCCGGGGGTACCTCTAGAGTCGACCTGCAGGCATGCAAGCTTAGTCCTAGATTCATTGGCCCTTTTCAGATTTTAAGCCGAGTGGGAGAGGTGGC
CTATAAGTTGGCCTTGCCACCTAGTTTGTCAGTAGTACATCCTGTTTTTCATGTCTCTATGCTTCGGAAGTATATTCCGGACGAATCTCATGTGCTTTCA
CTTGACTCTGTGGAGTTGGGTCCAGACTTGGCATTTGAGGAGGAGCCTATAGCTATTTTGGATAGGCAAATTCGAAAGCTTAGGACCAAAGAGATTGCTT
TAGTGAAGGTGCAATGGAAGCACCGATCAATGGGAGAGGAAAACTTGGGAGACTGAGTCTGACATGCGTGCCAGATATCCTCAACTTTTTGAAGCTTCAG
GTAATTACTTTTACTCTATGTTCGAGGACGAACATGTTTCTTAGTGGTGGATAATGTAATGACCCGGAAGGTCATTTTTGGAAATTCTTGAATATTTGCT
TAACTTGAGTTAATTAATCGATAGTTTATGGGCTAAAGTGATAATTTATTTAAGACCCTATACTCTTTAGCCTATATTTAATTAAATATGTGGGTAAAAC
CTATCACTTTTAGTAAAAAGATTTTGGTAAAAAAGATGATCTCACTTCTATAATTTTCATCTTTTATTCTCGTCCAACCCCTTTTCTTTAATATTTTAAA
TCAACAAACCAACTAATTATACAAAAAGGAGAAAAAGTTATTACTAAAGCATTTTTTTTGAAAAAAAACTTATTTTAATATAGAAAAATCATAACAAAAT
TACCTTCCTTTTAACCATTATCTGGAAACCAAACTTAAAAACCAAAAACAATAAAAAAAAAAAACCATATTTGGCCAAAATTTTCTAAAAAATAATATTT
TTTATTTTTGTG
>LE_HBa0018F22_T7_131216 (trimmed for quality and cloning vector)
AGCTTAGTCCTAGATTCATTGGCCCTTTTCAGATTTTAAGCCGAGTGGGAGAGGTGGCCTATAAGTTGGCCTTGCCACCTAGTTTGTCAGTAGTACATCC
TGTTTTTCATGTCTCTATGCTTCGGAAGTATATTCCGGACGAATCTCATGTGCTTTCACTTGACTCTGTGGAGTTGGGTCCAGACTTGGCATTTGAGGAG
GAGCCTATAGCTATTTTGGATAGGCAAATTCGAAAGCTTAGGACCAAAGAGATTGCTTTAGTGAAGGTGCAATGGAAGCACCGATCAATGGGAGAGGAAA
ACTTGGGAGACTGAGTCTGACATGCGTGCCAGATATCCTCAACTTTTTGAAGCTTCAGGTAATTACTTTTACTCTATGTTCGAGGACGAACATGTTTCTT
AGTGGTGGATAATGTAATGACCCGGAAGGTCATTTTTGGAAATTCTTGAATATTTGCTTAACTTGAGTTAATTAATCGATAGTTTATGGGCTAAAGTGAT
AATTTATTTAAGACCCTATACTCTTTAGCCTATATTTAATTAAATATGTGGGTAAAACCTATCACTTTTAGTAAAAAGATTTTGGTAAAAAAGATGATCT
CACTTCTATAATTTTCATCTTTTATTCTCGTCCAACCCCTTTTCTTTAATATTTTAAATCAACAAACCAACTAA

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.960444
Expected error %
0.7676
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT66771.1| Score 138 E Value 6e-36 Identity 65.30% Align. Length 357bp (52.97%) Frame 1
putative polyprotein [Solanum demissum]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAV31169.1| Score 137 E Value 2e-35 Identity 65.30% Align. Length 357bp (52.97%) Frame 1
putative polyprotein [Solanum tuberosum]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0018F22
Clone
Clone name
hba-18f22
LE_HBa0018F22
P018F22
Clone type
BAC
Contamination
none
Estimated length
77,134
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found