Clone Read LE_HBa0018H24_T7_131316

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0018H24_T7_131316
Primer
T7
ID from Seq. Facility
LE_HBa_018_H24-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
698 trimmed for vector and quality, 869 raw
Sequence
>LE_HBa0018H24_T7_131316 (raw untrimmed)
TTGGACCCGGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTGTAACAAGTGGTGTAGCGAGCCCTCCGCTTGGTTTAACCACCAACAGGCCATA
ATATGCATCAGTTACCTATAGATCACCAGTTTTGTTGTAAAATCCAAGGCCATACGGTCTTCCACAAGAAATTTGTGATATTGGGTCGTTTGTGCCATTA
CATATTTGTTTGGTCCTAAACATACATAATATATACGAAAATTTGTCAGTCGCTAATTCCTATTTTGTTAAAAAGATCAAGGTTAGAAATGGAATTTAAT
AACCTATTCGGTGATGTAATAGCAAATTCAGTGAAGCCAACATTTGGACCTTGATATTTCATTACTCTGCCATCTCCAACACCGGTGTAAGGTCCGACAC
CTTTTGTGTCGAAAGCAGAAGAGTCAGGGCCAAAGGCTTGTAATGGAAGTTGGAGTCGTGAAAATGCACAATGAACAAGGTAAGGTGAGGCATTTAAGAA
TATAAGAATCTGGAGAATTAGGAACATTGCTTTTGTAATTAAGATTATTCCCATGTTTGTTTGTGTTGTATCAATAACATAATCAACTGTTGATATTTAT
ACTACCAATTGCTCCACAGGGTGCTAGGGGTTTATCAAAATTAATTTAATTTAATTTTTAAAATTAATGAAATCAGATTCTTTGAAAAATGCAATGGAGT
ATAATTTTAAATTTACTGCTATGAAACTTCTATAAATTAAATGAAAGCCGTAAGATCTATATAGCCACAACAATAACGTTGGCAAAATTAAGTTTACCAA
ACGTATATTTTCCCTGAAGGAACCATTTTCAAAATCCTAATTTACAGTTAACTTTTCCCGGGCATAAAT
>LE_HBa0018H24_T7_131316 (trimmed for quality and cloning vector)
AGCTTGTAACAAGTGGTGTAGCGAGCCCTCCGCTTGGTTTAACCACCAACAGGCCATAATATGCATCAGTTACCTATAGATCACCAGTTTTGTTGTAAAA
TCCAAGGCCATACGGTCTTCCACAAGAAATTTGTGATATTGGGTCGTTTGTGCCATTACATATTTGTTTGGTCCTAAACATACATAATATATACGAAAAT
TTGTCAGTCGCTAATTCCTATTTTGTTAAAAAGATCAAGGTTAGAAATGGAATTTAATAACCTATTCGGTGATGTAATAGCAAATTCAGTGAAGCCAACA
TTTGGACCTTGATATTTCATTACTCTGCCATCTCCAACACCGGTGTAAGGTCCGACACCTTTTGTGTCGAAAGCAGAAGAGTCAGGGCCAAAGGCTTGTA
ATGGAAGTTGGAGTCGTGAAAATGCACAATGAACAAGGTAAGGTGAGGCATTTAAGAATATAAGAATCTGGAGAATTAGGAACATTGCTTTTGTAATTAA
GATTATTCCCATGTTTGTTTGTGTTGTATCAATAACATAATCAACTGTTGATATTTATACTACCAATTGCTCCACAGGGTGCTAGGGGTTTATCAAAATT
AATTTAATTTAATTTTTAAAATTAATGAAATCAGATTCTTTGAAAAATGCAATGGAGTATAATTTTAAATTTACTGCTATGAAACTTCTATAAATTAA

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.953058
Expected error %
0.7078
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At3g57030.1 Score 63 E Value 2e-21 Identity 58.20% Align. Length 390bp (55.87%) Frame 3
68416.m06348 strictosidine synthase family protein similar to strictosidine synthase [Rauvolfia serpentina][SP|P15324]
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At5g22020.1 Score 59 E Value 5e-18 Identity 57.40% Align. Length 393bp (56.30%) Frame 3
68418.m02562 strictosidine synthase family protein similar to SP|P15324 Strictosidine synthase precursor (EC 4.3.3.2) {Rauvolfia mannii}; contains Pfam profile PF03088: Strictosidine synthase
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
ref|NP_191262.2| Score 63 E Value 7e-20 Identity 58.20% Align. Length 390bp (55.87%) Frame 3
strictosidine synthase family protein [Arabidopsis thaliana]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
emb|CAB72173.1| Score 63 E Value 7e-20 Identity 58.20% Align. Length 390bp (55.87%) Frame 3
putative protein [Arabidopsis thaliana] pir||T47763 hypothetical protein F24I3.110 - Arabidopsis thaliana
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0018H24
Clone
Clone name
hba-18h24
LE_HBa0018H24
P018H24
Clone type
BAC
Contamination
none
Estimated length
78,911
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found