Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

Clone Read LE_HBa0018K15_T7_131442

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0018K15_T7_131442
Primer
T7
ID from Seq. Facility
LE_HBa_018_K15-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
726 trimmed for vector and quality, 927 raw
Sequence
>LE_HBa0018K15_T7_131442 (raw untrimmed)
CCGGGTCCCGGGGGGATCTCTAGAGTCGACCTGCAGGCATGCAAGCTTGTTAGATTTCCATGTGAATTAGAACTATTTAAGTTGTGAGCTTGTTCCCAAC
AAAATTTGCTAGTTATCTCACATGAAAACCTAGAATTTTTGTAAAAATTGTCTACTAGTAAAATATTTTTATGTCAATTTGAATTTAGAAGTTGTGACTT
GTTTCCCATAAAGTTTGTTAGTTTTTCACGTGAATTCAAATTCAGAAGTTGTGAGCTTGTTATAAAGATTGTTATTTTGTTCATATTAATATGAATTTCA
ATGTTGTGAGCTTGTTCCCAGTAAAATTTGTTAGTTTTTGCATGTGACAACTTTGATTCTTAAAGAAAAATTATCTATAATAACTTGACAATGCATAACT
GTCATCGACTTACAAGGAGCGTGGTTGTCAGCGACTTGCAGGGAGTGTAACTACTAGCGAATTTTTGTTTCATTAGGCAACTTTCATGTTAATTCGAATT
CAGATGTTTTGACCTTGTTCTCAATAAAATTTGTTAGTTTTTTCACGTAAAAATCTAGATTTTTCTAATAAAATTGTGTTTAGTAAAATATTTTCATGTG
AATTTGTATTACCAATAAAACTTGTTATGTTTTTCATATGAATTTGAATTTAGAAGTTGTTAGCTTGTTCCCCTAAAACTTGTTAGTTTTTGCAAAAATA
AATTTTATCTATAGTGACTTGGAAGTACGTAACTGGTTTACAAGGAGCATGAATACCCAACAACTTATAGGGAGTGTGATTACTACCGACTTGTCCGCTT
CCTTAAACAATTTCCACGTGAATTCAAATTTAAAAATTTGGGACCCTGCCCCCAATTAAAATTTGGTTTAGTTTTTTTTTTCCCCCTGAAACCCCAAAAA
TTTTTTTTAAAAAAAAAAACAAAAAAA
>LE_HBa0018K15_T7_131442 (trimmed for quality and cloning vector)
AGCTTGTTAGATTTCCATGTGAATTAGAACTATTTAAGTTGTGAGCTTGTTCCCAACAAAATTTGCTAGTTATCTCACATGAAAACCTAGAATTTTTGTA
AAAATTGTCTACTAGTAAAATATTTTTATGTCAATTTGAATTTAGAAGTTGTGACTTGTTTCCCATAAAGTTTGTTAGTTTTTCACGTGAATTCAAATTC
AGAAGTTGTGAGCTTGTTATAAAGATTGTTATTTTGTTCATATTAATATGAATTTCAATGTTGTGAGCTTGTTCCCAGTAAAATTTGTTAGTTTTTGCAT
GTGACAACTTTGATTCTTAAAGAAAAATTATCTATAATAACTTGACAATGCATAACTGTCATCGACTTACAAGGAGCGTGGTTGTCAGCGACTTGCAGGG
AGTGTAACTACTAGCGAATTTTTGTTTCATTAGGCAACTTTCATGTTAATTCGAATTCAGATGTTTTGACCTTGTTCTCAATAAAATTTGTTAGTTTTTT
CACGTAAAAATCTAGATTTTTCTAATAAAATTGTGTTTAGTAAAATATTTTCATGTGAATTTGTATTACCAATAAAACTTGTTATGTTTTTCATATGAAT
TTGAATTTAGAAGTTGTTAGCTTGTTCCCCTAAAACTTGTTAGTTTTTGCAAAAATAAATTTTATCTATAGTGACTTGGAAGTACGTAACTGGTTTACAA
GGAGCATGAATACCCAACAACTTATA

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.915453
Expected error %
0.6292
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0018K15
Clone
Clone name
hba-18k15
LE_HBa0018K15
P018K15
Clone type
BAC
Contamination
none
Estimated length
85,674
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found