Clone Read LE_HBa0018K23_T7_131458

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0018K23_T7_131458
Primer
T7
ID from Seq. Facility
LE_HBa_018_K23-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
7 trimmed for vector and quality, 1183 raw
Sequence
>LE_HBa0018K23_T7_131458 (raw untrimmed)
TGTTAATATTATGAGTATTCTTGGGGGTTTTTTATAGAAGTTTGACGTATGTATGGTATTGTTGAGGTTTTTTAGTTGATGAGTATAGGGGATGATTGTT
ACCGCCTTTTTTTTTTTTGTTTGGTTTTTTATTTTTTGATTTGTTTGAGGAAATGCATTTTTTTTTTTGTTTTTTTTTTTTTTTTTTTTATGTGGGTAGT
AAGAGAGTAGGAAATAGTGGTGTTGAAGAGGGTTTTTATGTATGAATTATTTTTTCTTTTTATACAAATATTGATGGTAGGTATATTGTGGATGGGAATG
TATGAGGATTGTGAATTAGTAGTAAAATGTTATAATTATAATGTATATGAGTTAATTTAGTTGTATTATAATGAGTGTAATTGTTATTTTGTTATATGTT
GTTGTTATTTTTGGTTTCTTTTGTGAGGATATGAGTGGTATTGTTTATGTATTGTGTTTGGTGTGTGGAGGAATGTTTAAGTTAGTATAAGTTTGTTTGT
GTAAGAGTATATTGAGATAATTAAATAGATGATTGAATGTATTGGTGGATGTTTT
TTTTTTTTTGTTTTTTTTTTTTTAATTGTTGTGTATGNATTAATT
TTTATTTTTGGGTGGGTGAGGAGTTTGATGTTTATATAATAATGTGTAAAATAATATAGATTAATTTTATGTTTGAAAAGGAATGTTTGTAGATGTTTGA
ATTGTTGTTTTGATTATGATTAACGAGTGTATTTGTTTTTGTTGTTCAGTTGAGGTATTTTTGATTTTTTTGGTGTGTTTGTAGTGAGAAGGGGGAGTGT
GATGTAGTTTGATTGTTGATATTTTAGTGTTTGATATATTATTAAGTGTATAAATAAATATTGAATATAATGATATTGTTGGTGTAATAATTTAGTTTGT
ATGATGTATATAATTTTTTAATATGGGAAGATTAATTAGTGGTCTTATTAATGAATAGTTTTAAAATGATGAGTATTAATTATATATATTATTAATATGT
TGATATAATGAATGGTTGAATATATTAATAGTTTTATTTTGATTATTTTTTATGTATATAAATATTTTATTTTTTTATTTGTATTATATATTTGTGTAAT
TTATTATATTGTATTTTTTAATTGTTCATTGTATGTAATTAATTATATTTTAGTATTTGTTGTATTTTATTGATATATTTTTA
>LE_HBa0018K23_T7_131458 (trimmed for quality and cloning vector)
TTTTTTT

This is probably not a useful sequence.

Problems:
  • Short cloning insert
  • Low complexity
Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
not recorded
Expected error %
0.4588
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0018K23
Clone
Clone name
hba-18k23
LE_HBa0018K23
P018K23
Clone type
BAC
Contamination
none
Estimated length
114,726
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found