Clone Read LE_HBa0019G01_T7_131990

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0019G01_T7_131990
Primer
T7
ID from Seq. Facility
LE_HBa_019_G01-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
743 trimmed for vector and quality, 850 raw
Genbank Accession
Sequence
>LE_HBa0019G01_T7_131990 (raw untrimmed)
CCTTGATCCCGGGGTTCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTTTTATAAAAATCCAATACAAACACCCTCTTAGATTATTTCTAACCTGATGCA
CGCTGTACTCTTCTCCAAACCTTCTATCATTCTACTACAACTTGTTTTTTTAAAAATAAATGAACTTGAAGGTATATACTTCTGCTATTAGTTTTAGAGA
AACACACACGATATAATTTATCTTGTGGGAACATGAGATATTCCCTCACGAAAATGAGGAATACAACCTCTGCAGACATGTCCGATTTATCAAACAGGAA
ACCATTTTGAAGAGAAACATTCAGAGAAGAAACTGAAGAGAATTGCAGAAGCAGTTACCTTGTGGTAACCTCCTGTATAATTGGTATGAGCTCGAAGGTC
ATCAATATCAATGCCATCAAGTGATCCAGAAATAAGAAGCTGAAAACAGGGCCAAAAAGTAAGACACAGATAACTAGACCTCTTACTAATTAAGAACATA
ACAATTATAATATATCTAGACTAGAACACAAAACAATTCTCGCCCATTGGATAATTTTCCAGCGTACAAGTAATTTTATCTTGTCCAGGCTTCTATTGAC
TTTCTTCTTCGCAATTATCGTTTTCTTTTTTTCATCTTCTTTGGGCAGCATACGACAGCTAGTTCTCAATAAGTTGGAGCTTGAAATGTAAGTCATTCAG
GCTTCATGCAAATCCTTCTCTCTCAAATTTTGTTCTTTCATAATTGCTCAGGTTTTTATATCCAAATGATTTATTCTCAGCAAAATATCCTGACAGATTA
AAGCACTACTAGCCTCTTTGTAAATGGGCTAGGGGGGATCTCAAAAAATT
>LE_HBa0019G01_T7_131990 (trimmed for quality and cloning vector)
AGCTTTTTATAAAAATCCAATACAAACACCCTCTTAGATTATTTCTAACCTGATGCACGCTGTACTCTTCTCCAAACCTTCTATCATTCTACTACAACTT
GTTTTTTTAAAAATAAATGAACTTGAAGGTATATACTTCTGCTATTAGTTTTAGAGAAACACACACGATATAATTTATCTTGTGGGAACATGAGATATTC
CCTCACGAAAATGAGGAATACAACCTCTGCAGACATGTCCGATTTATCAAACAGGAAACCATTTTGAAGAGAAACATTCAGAGAAGAAACTGAAGAGAAT
TGCAGAAGCAGTTACCTTGTGGTAACCTCCTGTATAATTGGTATGAGCTCGAAGGTCATCAATATCAATGCCATCAAGTGATCCAGAAATAAGAAGCTGA
AAACAGGGCCAAAAAGTAAGACACAGATAACTAGACCTCTTACTAATTAAGAACATAACAATTATAATATATCTAGACTAGAACACAAAACAATTCTCGC
CCATTGGATAATTTTCCAGCGTACAAGTAATTTTATCTTGTCCAGGCTTCTATTGACTTTCTTCTTCGCAATTATCGTTTTCTTTTTTTCATCTTCTTTG
GGCAGCATACGACAGCTAGTTCTCAATAAGTTGGAGCTTGAAATGTAAGTCATTCAGGCTTCATGCAAATCCTTCTCTCTCAAATTTTGTTCTTTCATAA
TTGCTCAGGTTTTTATATCCAAATGATTTATTCTCAGCAAAAT

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.947176
Expected error %
0.1683
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0019G01
Clone
Clone name
hba-19g1
LE_HBa0019G01
P019G01
Clone type
BAC
Contamination
none
Estimated length
96,304
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found