Clone Read LE_HBa0167L12_T7_13223

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0167L12_T7_13223
Primer
T7
ID from Seq. Facility
LE_HBa_167_L12-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
721 trimmed for vector and quality, 832 raw
Genbank Accession
Sequence
>LE_HBa0167L12_T7_13223 (raw untrimmed)
CTCTGGTCCCGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTCTTCTATCATATTATAAGGCTTCATATTATAAGGGGTTTTCAGGAGAGTTTG
AAGGTTTCTTCCACCCTAAAGGGTTTTCAGGAGAGGCTCAAAGAATTTAGGGTTTTCAGGAGAGGCTCAAAGAAAGGAGCAGGGGTATAACTGACAGAGT
CAAAGTGCTAATATCTAAAGTAAGATATTAAATATTGCATGCAATGATCAGAACAAACAGTATGAACATAACATAACAGAAATCTTTCATAATGTCATAC
CTTTTTTTGTTGATGGTTGTCGTTTTCTTCTTGAGCAGCCTGAGTTAGATGTTGCACTTGTTTATACAAGTCGTTTATTGTTTTTTCCAAACCCTTTTTA
GTTATTGTTTTATTAATTTGAATGTCGGTAATATTTGTTTACATCTTGTAACTATTTTGAGTAAAAAAATTAACGATTGATAATGAAAAATGACAACGAA
AAATACTTTAATCATAAACATTTTAATGGACCTCTTCACATTAAATTTACGCAAACAAAAAGTAATCAACAACTTAATCTAAAAATTGTATATACTAGCA
AACTATTAATTCAAATTAAATGCTATAAATATACTTTGATTTAATTGTACCCTATAACAAACTATAGCTATTTTCGCCACTTTCCTTGGTTTGATCTCGC
TCGCCACTCTCGTTTGGTGGGAGTTTCCCTCGCCTTTTCTCCGCTTTTTAAACAAACCCAAATGTATAAAATGTGTGTTTGTATAAAGCGAGAGGAAAAG
TATAAATTAGGGATGTCAAAAATGAAACTCAA
>LE_HBa0167L12_T7_13223 (trimmed for quality and cloning vector)
AGCTTCTTCTATCATATTATAAGGCTTCATATTATAAGGGGTTTTCAGGAGAGTTTGAAGGTTTCTTCCACCCTAAAGGGTTTTCAGGAGAGGCTCAAAG
AATTTAGGGTTTTCAGGAGAGGCTCAAAGAAAGGAGCAGGGGTATAACTGACAGAGTCAAAGTGCTAATATCTAAAGTAAGATATTAAATATTGCATGCA
ATGATCAGAACAAACAGTATGAACATAACATAACAGAAATCTTTCATAATGTCATACCTTTTTTTGTTGATGGTTGTCGTTTTCTTCTTGAGCAGCCTGA
GTTAGATGTTGCACTTGTTTATACAAGTCGTTTATTGTTTTTTCCAAACCCTTTTTAGTTATTGTTTTATTAATTTGAATGTCGGTAATATTTGTTTACA
TCTTGTAACTATTTTGAGTAAAAAAATTAACGATTGATAATGAAAAATGACAACGAAAAATACTTTAATCATAAACATTTTAATGGACCTCTTCACATTA
AATTTACGCAAACAAAAAGTAATCAACAACTTAATCTAAAAATTGTATATACTAGCAAACTATTAATTCAAATTAAATGCTATAAATATACTTTGATTTA
ATTGTACCCTATAACAAACTATAGCTATTTTCGCCACTTTCCTTGGTTTGATCTCGCTCGCCACTCTCGTTTGGTGGGAGTTTCCCTCGCCTTTTCTCCG
CTTTTTAAACAAACCCAAATG

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.942296
Expected error %
0.778249
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0167L12
Clone
Clone name
hba-167l12
LE_HBa0167L12
C12HBa0167L12
P167L12
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found