Clone Read LE_HBa0019P03_T7_132426

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0019P03_T7_132426
Primer
T7
ID from Seq. Facility
LE_HBa_019_P03-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
730 trimmed for vector and quality, 852 raw
Genbank Accession
Sequence
>LE_HBa0019P03_T7_132426 (raw untrimmed)
GACAGGGTACCGGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTAGCTAGATCCATTCATACTTTGTTTATTTAACAATAAATACATAGATTTT
TAAAAAAAATAAGGTTTTAACTGTGTGTAACATTAATTTATTCAGAATTAAAAAATATGATTTGCTTCCATGTTACTCGATGAAAGAGCAAAATCCGAAA
AAAGTAGGTGGAAATTAGATTAAGCTAATCATTCCTTTAAGATCCTGTTATACTTGTAATTATTGGTGCAATAGCTAACGCGCTTGATACAGCGCGTGAA
GCCTGAAAGTTATTCCTTGCTTCCTGGCATTGTCGGTAACAATGCAATCAGCCGCAGTGTTATCCGGCCCGTGACTTTTGTCACATGATGATTTGATCAT
ACATTTTTATTCTTTTATTAATTAGAATTGAATTTTTATTAATAAAGTAAAAATTAATATTTATTCAGGTACCAAGACGGGACTGCGACGCAGCCACCTG
CAGCTTCAACCTAACCTACGGTGGTTCGAGCATAGGTGGAACCCTCTCATCGGAAACATTGGCACTCGCCACCGATCCGGTACCCGGATTTCTCTTTGGT
TGCGTAAAAAAGATCTCCGGCAGCAACACACCACCTCAGGGTCTATTAGCTTTGGGCCGTGGTTTATTATCATTTATATCCCAATCTGAAAGCCTCTACA
AGTCCACATTCTCCTATTGTTTGCCCAGTTACAAATCTCCCCAATTTTTCTGGCACACTTAGATTAGGCCCAAAAGGCCCAGCCACTGAGGATTAAAACC
CCCCCCTTTGCTAAGAAACCCCAAGGAGATCCTTCCTTTTTCCTATGTTCAA
>LE_HBa0019P03_T7_132426 (trimmed for quality and cloning vector)
AGCTTAGCTAGATCCATTCATACTTTGTTTATTTAACAATAAATACATAGATTTTTAAAAAAAATAAGGTTTTAACTGTGTGTAACATTAATTTATTCAG
AATTAAAAAATATGATTTGCTTCCATGTTACTCGATGAAAGAGCAAAATCCGAAAAAAGTAGGTGGAAATTAGATTAAGCTAATCATTCCTTTAAGATCC
TGTTATACTTGTAATTATTGGTGCAATAGCTAACGCGCTTGATACAGCGCGTGAAGCCTGAAAGTTATTCCTTGCTTCCTGGCATTGTCGGTAACAATGC
AATCAGCCGCAGTGTTATCCGGCCCGTGACTTTTGTCACATGATGATTTGATCATACATTTTTATTCTTTTATTAATTAGAATTGAATTTTTATTAATAA
AGTAAAAATTAATATTTATTCAGGTACCAAGACGGGACTGCGACGCAGCCACCTGCAGCTTCAACCTAACCTACGGTGGTTCGAGCATAGGTGGAACCCT
CTCATCGGAAACATTGGCACTCGCCACCGATCCGGTACCCGGATTTCTCTTTGGTTGCGTAAAAAAGATCTCCGGCAGCAACACACCACCTCAGGGTCTA
TTAGCTTTGGGCCGTGGTTTATTATCATTTATATCCCAATCTGAAAGCCTCTACAAGTCCACATTCTCCTATTGTTTGCCCAGTTACAAATCTCCCCAAT
TTTTCTGGCACACTTAGATTAGGCCCAAAA

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.969078
Expected error %
0.3394
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At5g07030.1 Score 124 E Value 6e-29 Identity 62.80% Align. Length 306bp (41.92%) Frame 2
68418.m00796 aspartyl protease family protein contains Pfam profile:PF00026 eukaryotic aspartyl protease
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At3g54400.1 Score 113 E Value 1e-25 Identity 17.50% Align. Length 308bp (42.19%) Frame 2
68416.m06015 aspartyl protease family protein contains Pfam profile: PF00026 eukaryotic aspartyl protease
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAM62745.1| Score 124 E Value 3e-27 Identity 62.80% Align. Length 306bp (41.92%) Frame 2
nucleoid DNA-binding-like protein [Arabidopsis thaliana] dbj|BAB11161.1| nucleoid DNA-binding-like protein [Arabidopsis thaliana] ref|NP_196320.1| aspartyl protease family protein [Arabidopsis thaliana]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
emb|CAB81805.1| Score 113 E Value 6e-24 Identity 17.50% Align. Length 308bp (42.19%) Frame 2
nucleoid DNA-binding-like protein [Arabidopsis thaliana] gb|AAM70549.1| AT3g54400/T12E18_90 [Arabidopsis thaliana] gb|AAL49945.1| AT3g54400/T12E18_90 [Arabidopsis thaliana] ref|NP_191008.1| aspartyl protease family protein [Arabidopsis thaliana] pir||T47599 nucleoid DNA-binding-like protein - Arabidopsis thaliana
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0019P03
Clone
Clone name
hba-19p3
LE_HBa0019P03
P019P03
Clone type
BAC
Contamination
none
Estimated length
86,497
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found