Clone Read LE_HBa0019P04_SP6_132427

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0019P04_SP6_132427
Primer
SP6
ID from Seq. Facility
LE_HBa_019_P04-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
661 trimmed for vector and quality, 827 raw
Genbank Accession
Sequence
>LE_HBa0019P04_SP6_132427 (raw untrimmed)
AGGGAACTTTCCNGTTTNGCACTTNCGGTTTACNTTTCTTAAAAATGAATTCAAAAAGTACATNAGGGTGATGAAACTGATGAACACTTTTCATATCGAG
GTTTTGTCTTTCTTTTGCATTTACACCTTGATTATTTTTTCTAAATATTAGTTCTTGTTTCTTCATGCATTGATTCTCCTTTACATGCACTTTTGCTTGT
CACCTCCTTTCTGCACCAAAAGTATCATTCTTCTCTATTTCAAGTTAGTGTAAATATTTTAATTTTGATTGTCTATCGTCGAAGGCGGATCCATGATTTT
GAAAGTTATGAGTTCCTACAATGACTTCAAGTTAGCATATGTTAATAAGTGGACTCACACTAAAATTTATAAATATGTAGTAAATTTTAATGCATATATA
GCGAACATTTGATGCTTCTAGACTGTAACTTTGTTAACTGCGTTCTTCTTGTAATTTTAAGTTTTATGTTGTACTTCCTTCTAGTCATGCAGTCATCAAC
TTGTTCAAACATGAGTAGTTTTTCTGGTGAACACTTCCACACTTTCAGATTACCTGCAGTTTGCCGGTCCCTGAAGTTGAAACCAACAAATCAGTCCGTG
CATTTCTTTTGGTTGTGCATGGAGTTTTTTCTTTTTTATCTAAGGTTCTTATAGTTTCAAACTGTTGATCTCAGGTTGTTGCTAAAATCGCTAAAGTGTT
TCCTAAAGATACTGAGGCTCCTCCTGGAGGTGTAGATGATATGAACAAACTTTCCTATTTTGCATGAACCTGGAGTTTTTGCCGAACTTGGCCCACCCGA
ATATGAAGCTCAAATGAAATTTTATGT
>LE_HBa0019P04_SP6_132427 (trimmed for quality and cloning vector)
TCTTAAAAATGAATTCAAAAAGTACATNAGGGTGATGAAACTGATGAACACTTTTCATATCGAGGTTTTGTCTTTCTTTTGCATTTACACCTTGATTATT
TTTTCTAAATATTAGTTCTTGTTTCTTCATGCATTGATTCTCCTTTACATGCACTTTTGCTTGTCACCTCCTTTCTGCACCAAAAGTATCATTCTTCTCT
ATTTCAAGTTAGTGTAAATATTTTAATTTTGATTGTCTATCGTCGAAGGCGGATCCATGATTTTGAAAGTTATGAGTTCCTACAATGACTTCAAGTTAGC
ATATGTTAATAAGTGGACTCACACTAAAATTTATAAATATGTAGTAAATTTTAATGCATATATAGCGAACATTTGATGCTTCTAGACTGTAACTTTGTTA
ACTGCGTTCTTCTTGTAATTTTAAGTTTTATGTTGTACTTCCTTCTAGTCATGCAGTCATCAACTTGTTCAAACATGAGTAGTTTTTCTGGTGAACACTT
CCACACTTTCAGATTACCTGCAGTTTGCCGGTCCCTGAAGTTGAAACCAACAAATCAGTCCGTGCATTTCTTTTGGTTGTGCATGGAGTTTTTTCTTTTT
TATCTAAGGTTCTTATAGTTTCAAACTGTTGATCTCAGGTTGTTGCTAAAATCGCTAAAGT

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.939599
Expected error %
0.4002
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0019P04
Clone
Clone name
hba-19p4
LE_HBa0019P04
C07HBa0019P04
P019P04
Clone type
BAC
Contamination
none
Estimated length
105,132
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found