Clone Read LE_HBa0020D21_SP6_132653

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0020D21_SP6_132653
Primer
SP6
ID from Seq. Facility
LE_HBa_020_D21-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
649 trimmed for vector and quality, 949 raw
Genbank Accession
Sequence
>LE_HBa0020D21_SP6_132653 (raw untrimmed)
CTGGTTTTTCGGCTTGGCCCGCCCAAAAGAAGAAGAGAAGAGAAGAGAAGGGTGACCTGTAGATAATGGAAAGTAAAGGAGGAGGAACTGAAGCACACCC
GTATGTATGGGAAGGAGCAATCCCTCTGCAGATTCATCTTCATGAATCCAAAATGACTACTCTCCCTACTCCTCCCCCTGCTATGATTTTAGCTCCTCGA
ATTGGGTACCTGCCTCTTTTAGCACAAAAAGTAAAGCCTTTCTTCAGTAATTCACTTCCTCCAGGTGTAGATACGATATGGTTTGAGTACAATGGCTTGC
CTCTCAAATGATATATACCTACTGGGGTAATCTTTGATCTTCTTTGTGCAGAACCTGAACGGCCTTGGAATCTGACAGTACATTTTAGAGGATATCCTGG
AAATATTTTAACACCCTGTGACAGTGAAGATAGTGTAAAATGGAGCTTTATTAATTCATTTAAAGAGGCAGCATATATAATCAATGGGAACTGCAAAAAT
GTAATGAATATGTCCCAATCTGACCAATTAGAACTCTGGCGCTCCATTATGGATGGTGATTTGGACTCTTATCTTCGAATCTCATCTAAGCTAAAATTCA
GCATTCTTGTGGATGATTTTTTGATAAAATTGAACATTTCCTCTCCTAAATCACCTGAAAGCACTCAAAATGCAGATGGCACAGCACCAAGCTAAACTGG
TAGAATACCGGTTCGACTGTATGTTAGAACTATCAATGAGGATTTTGACGAGTTGGAAGATGCCCCTGTTGTTGAAAATTGGGACAAATCCTCTAATAAA
ACGACCTGTTCAGATCCTGGAGATGGGAAATGCTTCCCTTGGTCGAAGAGGAACAAAATTTTGCAGAATTTTTTGGGAAAAATTCCCCAACAATGATGTT
TTTAAAAAAAATTGAGATTGAGGAAATTCTTTTTAAAAAAAAAACAAAG
>LE_HBa0020D21_SP6_132653 (trimmed for quality and cloning vector)
AAAAGAAGAAGAGAAGAGAAGAGAAGGGTGACCTGTAGATAATGGAAAGTAAAGGAGGAGGAACTGAAGCACACCCGTATGTATGGGAAGGAGCAATCCC
TCTGCAGATTCATCTTCATGAATCCAAAATGACTACTCTCCCTACTCCTCCCCCTGCTATGATTTTAGCTCCTCGAATTGGGTACCTGCCTCTTTTAGCA
CAAAAAGTAAAGCCTTTCTTCAGTAATTCACTTCCTCCAGGTGTAGATACGATATGGTTTGAGTACAATGGCTTGCCTCTCAAATGATATATACCTACTG
GGGTAATCTTTGATCTTCTTTGTGCAGAACCTGAACGGCCTTGGAATCTGACAGTACATTTTAGAGGATATCCTGGAAATATTTTAACACCCTGTGACAG
TGAAGATAGTGTAAAATGGAGCTTTATTAATTCATTTAAAGAGGCAGCATATATAATCAATGGGAACTGCAAAAATGTAATGAATATGTCCCAATCTGAC
CAATTAGAACTCTGGCGCTCCATTATGGATGGTGATTTGGACTCTTATCTTCGAATCTCATCTAAGCTAAAATTCAGCATTCTTGTGGATGATTTTTTGA
TAAAATTGAACATTTCCTCTCCTAAATCACCTGAAAGCACTCAAAATGC

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.954323
Expected error %
0.3533
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At5g17290.1 Score 295 E Value 1e-80 Identity 23.30% Align. Length 569bp (87.67%) Frame 1
68418.m02025 autophagy protein Apg5 family contains Pfam profile: PF04106 autophagy protein Apg5
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
dbj|BAC42232.1| Score 295 E Value 5e-79 Identity 23.30% Align. Length 569bp (87.67%) Frame 1
APG5 (autophagy 5) like protein [Arabidopsis thaliana] gb|AAO50633.1| putative APG5 (autophagy 5) protein [Arabidopsis thaliana] ref|NP_197231.1| autophagy protein Apg5 family [Arabidopsis thaliana] dbj|BAB10516.1| APG5 (autophagy 5)-like protein [Arabidopsis thaliana]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
ref|XP_463888.1| Score 265 E Value 7e-70 Identity 20.70% Align. Length 593bp (91.37%) Frame 1
APG5 (autophagy 5)-like protein [Oryza sativa (japonica cultivar-group)] dbj|BAD07611.1| APG5 (autophagy 5)-like protein [Oryza sativa (japonica cultivar-group)] dbj|BAD07730.1| APG5 (autophagy 5)-like protein [Oryza sativa (japonica cultivar-group)]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0020D21
Clone
Clone name
hba-20d21
LE_HBa0020D21
P020D21
Clone type
BAC
Contamination
none
Estimated length
101,725
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found