Clone Read LE_HBa0020H14_SP6_132831

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0020H14_SP6_132831
Primer
SP6
ID from Seq. Facility
LE_HBa_020_H14-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
715 trimmed for vector and quality, 972 raw
Genbank Accession
Sequence
>LE_HBa0020H14_SP6_132831 (raw untrimmed)
TGGAAACCATTCACGAAGTATTTACTGCAAGTTACTNTGTTAACACATAGAAATTGGCTAACATCCGTAAGCCAATATTCTCTAACATGCCCAACATTAC
TCAATATTGGGCATTGGGATCCCTATGTACCCCAATACATATTCTTAAAACCTAATAGACTCTTCATTAGACAAGTACCTTTTCTGGAATGTTACATTAT
CCCCTCCTTAGGAACATTCGTCCCCCCCCCCCAATGATACTACATATCATTTTGAATCAATGAGGGTATTTTTTAAAAACACATCAACATACTTGAGACT
TTAGTCTTTGTGAATATCTAATTCACAACTTACTCTGGATGATGCACATTACTCAAAGGTTATTCTGAAGCTTCATATCTGATATTGAGGAACTTCCTTC
TCAATTTCACTTTAACTCAGTGCACATCACAACTCATGCAACACAAAAATCACGCCAATGCTATACAAAAACTGCAACATGAATGCAAGCATGAAATCAT
ATTAACTCATGTAGTGCAAATATAAAACACACAGTTATGGACTTAAAACACCAAAAATGACTAATTTACTAAAGTTAAGAGTTTCATAAACAAAGTAAGA
CTTAAAAAGAGTATATCTAACCTCAGGAACTGAACAAGTGAGATTAATGGGATCTCATGTCGTCCTCGACCTCCCATGTTTCTCCCTCAACAAGGTGGTT
CCTCTATAACACCTTCACGGTGGCAACCTCCTTATTCCTTAGCTTCTTCACTTGGCGATCTAAAATTTTAACTAAAACCTCTTCATAATAAAGGTTCTCA
TCGACTACAACCCCCTCAACAAACAGGATGGATACTGGATTACCTAGACACTTTTTAAACCTCGAAACATGAAACCTGGGATGAAAGAAGCCAATTATTT
GGAAATTCAGTTATAGGAACATTCCTACCCCTGTAAAACCCAAAAAAACTATATACTTGGATTACTTCCCTT
>LE_HBa0020H14_SP6_132831 (trimmed for quality and cloning vector)
TTAACACATAGAAATTGGCTAACATCCGTAAGCCAATATTCTCTAACATGCCCAACATTACTCAATATTGGGCATTGGGATCCCTATGTACCCCAATACA
TATTCTTAAAACCTAATAGACTCTTCATTAGACAAGTACCTTTTCTGGAATGTTACATTATCCCCTCCTTAGGAACATTCGTCCCCCCCCCCCAATGATA
CTACATATCATTTTGAATCAATGAGGGTATTTTTTAAAAACACATCAACATACTTGAGACTTTAGTCTTTGTGAATATCTAATTCACAACTTACTCTGGA
TGATGCACATTACTCAAAGGTTATTCTGAAGCTTCATATCTGATATTGAGGAACTTCCTTCTCAATTTCACTTTAACTCAGTGCACATCACAACTCATGC
AACACAAAAATCACGCCAATGCTATACAAAAACTGCAACATGAATGCAAGCATGAAATCATATTAACTCATGTAGTGCAAATATAAAACACACAGTTATG
GACTTAAAACACCAAAAATGACTAATTTACTAAAGTTAAGAGTTTCATAAACAAAGTAAGACTTAAAAAGAGTATATCTAACCTCAGGAACTGAACAAGT
GAGATTAATGGGATCTCATGTCGTCCTCGACCTCCCATGTTTCTCCCTCAACAAGGTGGTTCCTCTATAACACCTTCACGGTGGCAACCTCCTTATTCCT
TAGCTTCTTCACTTG

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.946085
Expected error %
0.0721
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0020H14
Clone
Clone name
hba-20h14
LE_HBa0020H14
C03HBa0020H14
P020H14
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found