Clone Read LE_HBa0020N06_SP6_133103

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0020N06_SP6_133103
Primer
SP6
ID from Seq. Facility
LE_HBa_020_N06-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
488 trimmed for vector and quality, 930 raw
Genbank Accession
Sequence
>LE_HBa0020N06_SP6_133103 (raw untrimmed)
GGCCCCCCCGGAAACTATAAGTATTATTTCCGTGGATTTCATCACCACGTATACGGGATTTCCCTTTTGGGTTCCTTTCTCCCATTGGGTCCCTAGTTTT
CACTCATATTCTTAATTCATTAAATATATGTTATAAATCACATTATCATGTTATTATTCAGTTTATTGCATGAATTTCAAAACCCTAGCTTTGTATTTCT
TTAGTTCTTGAATTACACATGCTAGGTCATATTTTTCAGACACTTCAGATGTACATGCATCAGTTATAAATGCATAATAACCAGATTAATTGTTGTATTA
TCAGTTTGCCTGTTCTGTTTTTGAGCTATCCAGTATTTACAGAAATTCAGATATAATAAGTTAATTTACAGAATTTATTGGGAGTAGCATAATACCGAGT
TGGACTAGGGTTTAGCGTACCCAATAGTCCCAAGACTACTAGCCGAGTAAGTTGTAAGTCCCCTCTATGAGAAATCAATTTAGTGATCACGCCAGCATGC
CTTTATACCTTTGGCAAGGTATATTGGGTCCTCCTCAATTGAGCGTATACATCGGACTCCATATTTAGATCATGTGGTTTTATTATCTGGTATTAGTAGC
TCCCACAATTCCGTCACTTTTCTACATCGACCGATTATCGAGAAATTCATTATTCAGGATCAGCACGGTATAAATTGTTCTCTGCATCCAATTAGCTCAA
AATCACCGAACGGGTGCCAAATCAACATATACGCGTTGTGCTTGTGAATCGAAATTAAATTTATCTGCACCCAAACCAAACCCTAATTCGTNTAAAGGAC
TGGNNCNACCGNCATACCCCCTCTGCGGAATAATGTCAACGCCCCACCACTCCGGAACCTCACTTAACATCAAGGCCTAACGGCGGCGCTATGGGAGAAC
CCTGCGGCCCCGAGTGACTACGTGAGCTAT
>LE_HBa0020N06_SP6_133103 (trimmed for quality and cloning vector)
GTGGATTTCATCACCACGTATACGGGATTTCCCTTTTGGGTTCCTTTCTCCCATTGGGTCCCTAGTTTTCACTCATATTCTTAATTCATTAAATATATGT
TATAAATCACATTATCATGTTATTATTCAGTTTATTGCATGAATTTCAAAACCCTAGCTTTGTATTTCTTTAGTTCTTGAATTACACATGCTAGGTCATA
TTTTTCAGACACTTCAGATGTACATGCATCAGTTATAAATGCATAATAACCAGATTAATTGTTGTATTATCAGTTTGCCTGTTCTGTTTTTGAGCTATCC
AGTATTTACAGAAATTCAGATATAATAAGTTAATTTACAGAATTTATTGGGAGTAGCATAATACCGAGTTGGACTAGGGTTTAGCGTACCCAATAGTCCC
AAGACTACTAGCCGAGTAAGTTGTAAGTCCCCTCTATGAGAAATCAATTTAGTGATCACGCCAGCATGCCTTTATACCTTTGGCAAGG

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.9432
Expected error %
0.1519
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0020N06
Clone
Clone name
hba-20n6
LE_HBa0020N06
P020N06
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found