Clone Read LE_HBa0022O07_T7_133922

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0022O07_T7_133922
Primer
T7
ID from Seq. Facility
LE_HBa_022_O07-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
765 trimmed for vector and quality, 955 raw
Genbank Accession
Sequence
>LE_HBa0022O07_T7_133922 (raw untrimmed)
AGTAACCGGGCCCGGGGGAACCTCTAGAGTCGACCTGCAGGCATGCAAGCTTTTTAACAAGTTTTGTAATGATCCTTAGCGGATGAAAGAAGAGCTTGAT
TTCGTTTTAGCAAACATTCATTTATAAAATTCTCTACTGAATTGATTACTAACTTTATGTGGCATTTATTTTGCGACAAAATAAGTATTTCAGTTCTATC
AAACATTTGAGGACAGCAGCTGGTGAAAAGTAGTGTTGGCCATAGAAATTTCTAATCAAATTGCATTTTTAAATGCTTATTACTTCAATGGCAAGGGGGT
ATAATAGGTATTATCAAAATTAACTTTTAGCTTTCTCTTTGGAAATTCTAGTTGTAGTGCAATTTTCATTTCATGATATATATTACTGCTTTTCTCATAA
TTCAATTTGTATATTCTAAGGAATAAGAAGTTAATTAATCAGCACCAGAAAACACACAGTAATAGAAAAAAACAAATGAAAATATCATTGGAAGGGTTGA
TGCCTGATTAAGTTGTTTCGGTGTAAATTCATGTGAACCCAATATCTTTTATTCTAATGATTGATTTTTTGGTGAAATTTAATAAAAATTATACAATTAT
TAGTAAATTCATCTTAACCCAATATCTTTTATTCTAATGATTGATTTTTAGGTGAAATTTTAAAAAAAATCTACAATTATTATTTTTTTGCAAAAGACAA
ATAATTCATTCCGTGCTAAAAGAATTACATTTTGAACTCATCAAGTTGATAATTCAGATCCACCTATAATAATAAATACACACCAAAAATAAAAATAAAT
AATTAGAAAATTCCCCATTGAAAATTTATGTAAATTACCCATTGGATGTTTTCTCATATTGGAAACAATGCCCTGGCCAAAGGACCAAGCCACCCCAACA
AAATAAGGTGACTGAAAATGCAACTTCATACCGATAACTTCTTTATTTCTTTGAA
>LE_HBa0022O07_T7_133922 (trimmed for quality and cloning vector)
AGCTTTTTAACAAGTTTTGTAATGATCCTTAGCGGATGAAAGAAGAGCTTGATTTCGTTTTAGCAAACATTCATTTATAAAATTCTCTACTGAATTGATT
ACTAACTTTATGTGGCATTTATTTTGCGACAAAATAAGTATTTCAGTTCTATCAAACATTTGAGGACAGCAGCTGGTGAAAAGTAGTGTTGGCCATAGAA
ATTTCTAATCAAATTGCATTTTTAAATGCTTATTACTTCAATGGCAAGGGGGTATAATAGGTATTATCAAAATTAACTTTTAGCTTTCTCTTTGGAAATT
CTAGTTGTAGTGCAATTTTCATTTCATGATATATATTACTGCTTTTCTCATAATTCAATTTGTATATTCTAAGGAATAAGAAGTTAATTAATCAGCACCA
GAAAACACACAGTAATAGAAAAAAACAAATGAAAATATCATTGGAAGGGTTGATGCCTGATTAAGTTGTTTCGGTGTAAATTCATGTGAACCCAATATCT
TTTATTCTAATGATTGATTTTTTGGTGAAATTTAATAAAAATTATACAATTATTAGTAAATTCATCTTAACCCAATATCTTTTATTCTAATGATTGATTT
TTAGGTGAAATTTTAAAAAAAATCTACAATTATTATTTTTTTGCAAAAGACAAATAATTCATTCCGTGCTAAAAGAATTACATTTTGAACTCATCAAGTT
GATAATTCAGATCCACCTATAATAATAAATACACACCAAAAATAAAAATAAATAATTAGAAAATT

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.903469
Expected error %
1.4819
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0022O07
Clone
Clone name
hba-22o7
LE_HBa0022O07
P022O07
Clone type
BAC
Contamination
none
Estimated length
97,835
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found