Clone Read LE_HBa0022P08_SP6_133971

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0022P08_SP6_133971
Primer
SP6
ID from Seq. Facility
LE_HBa_022_P08-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
643 trimmed for vector and quality, 931 raw
Genbank Accession
Sequence
>LE_HBa0022P08_SP6_133971 (raw untrimmed)
TTTTTTCTCCCAAGTGATAGGTAGGTAAAAAATTANGTTTATATTATATTCAATGGTGTAAATCAATTTTCATACTAGTAATAATTATATGCATGTTAAT
TACCAGTTCTATCACCCTATCATGTCACTCGGAAAATATCTACTAGCTAAGTCTACTATTAATAATCTCGAAAATAAGATATATTGTTTATTATATGAAA
TATAGGCAACGGTGATCTGATAGTATAAAGTATCTCTATATCTATAAACGATATATGTATATAGCTTAAACTCTTGTACGTATATACTAAGGTATGACTT
AATGGTCTTGCGTTTAAATCCCAGTTGAAACGAAAGTGCTTGGTGATTTAATTTCATCATGTCTATTTAAGTGCTATTGAATAGAGTTATCTAATACTTG
TGTGTATAGACTTAGTTAGCCTAAAAAATTTTCTTTTTCCATTCGCTGTTTGATATCCACATGGGAGCCCGACTTAGTTTGGATTTATGTCGAAAAGTCT
CATTGGGGCAAAGCACTCTGGTTAAACTTACCGCTCCACCATAACCCTTGTAAAACAATAATTAATCTATTATAATAAGTATCTCAATATTACATATAGT
TATATTTTAAATGACCTGATTGTCAGTATTATATAAGCTATTGTGATAATTTCAACAGGTTTTTACCAACAAGAAGAAATAGAAGAATGAAAGGCATTGA
CAATGAACTCAAAGATACTTTAAGGAAAATTGTCAACGAAAGAGAAAGATCCATGAATTTGGGAGAAACTCAAGAGGATTTGTTGGGGATCTTATTAAAG
TCCAATGTGATTGAAATTCAACAATTGGGACCCAATTTGGTATGACCATTGATGAAGTAAGAAAAAAATGCAAACTTTTTTATTTTGCTGGCCAACAGAC
TCTTTAAATTTATTATTTTGGTTTTGGTTTT
>LE_HBa0022P08_SP6_133971 (trimmed for quality and cloning vector)
TAATAATTATATGCATGTTAATTACCAGTTCTATCACCCTATCATGTCACTCGGAAAATATCTACTAGCTAAGTCTACTATTAATAATCTCGAAAATAAG
ATATATTGTTTATTATATGAAATATAGGCAACGGTGATCTGATAGTATAAAGTATCTCTATATCTATAAACGATATATGTATATAGCTTAAACTCTTGTA
CGTATATACTAAGGTATGACTTAATGGTCTTGCGTTTAAATCCCAGTTGAAACGAAAGTGCTTGGTGATTTAATTTCATCATGTCTATTTAAGTGCTATT
GAATAGAGTTATCTAATACTTGTGTGTATAGACTTAGTTAGCCTAAAAAATTTTCTTTTTCCATTCGCTGTTTGATATCCACATGGGAGCCCGACTTAGT
TTGGATTTATGTCGAAAAGTCTCATTGGGGCAAAGCACTCTGGTTAAACTTACCGCTCCACCATAACCCTTGTAAAACAATAATTAATCTATTATAATAA
GTATCTCAATATTACATATAGTTATATTTTAAATGACCTGATTGTCAGTATTATATAAGCTATTGTGATAATTTCAACAGGTTTTTACCAACAAGAAGAA
ATAGAAGAATGAAAGGCATTGACAATGAACTCAAAGATACTTT

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.93246
Expected error %
0.8239
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0022P08
Clone
Clone name
hba-22p8
LE_HBa0022P08
C07HBa0022P08
P022P08
Clone type
BAC
Contamination
none
Estimated length
85,446
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found