Clone Read LE_HBa0022P08_T7_133972

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0022P08_T7_133972
Primer
T7
ID from Seq. Facility
LE_HBa_022_P08-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
823 trimmed for vector and quality, 927 raw
Genbank Accession
Sequence
>LE_HBa0022P08_T7_133972 (raw untrimmed)
CACAACCGGGTAACCGGGGGACCTCTAGAGTCGACCTGCAGGCATGCAAGCTTTTCATCCTTCATTTTGATTTTCGCTCTTGGATAATGTAGAAAACAAA
GTTCACCTTGACCAATTTTTTCGTTGTCCACAATCCAGTATCATTTATCTTTATTTTCAGGCCTACATTCATGAGAATAATGAGGAATCAATCAACTGAA
CAGTTCTCAGGGTTGCCGTACATCTATGGTCTATTGAACTGCTTAATTTGTGCCTGGTATGGCACCCCTCTCGTATCTCCCGACAATTTGTTGGTTACAT
CAGTTAATTCAGTTGGTGCTGTTTTTCAACTTGCCTACATTGTACTTTACGTAACGTATACAGAGAAAGAGAAAAAGGTTAATACTCTTCTGTTGTATTA
TTTAATTAATAAAGCAGTTTCACACTCATTCATAGCGTAATCTGTTAATCCGTATGCCCATCAATGTTGTTTGTAGTTCAGGATGTTTGGATGGATACTC
ACAGTCTTTGGCCTATTTGTTATTATTGTACTTGGAAGCTTGTTTATACTTGATCTGGAACTCCGACGCATCATCATTGGCTCCCTGAGTTGTGCTTCCT
TGATATCAATGTTTGCCTCCCCACTGTTAATTATTGTATGTCTAACCGTTGACATTCAGAATTTTCTATCAAGTTCTTGTTCTCTAACGTTTTTCCGCGG
ATTCACTGACTAACTTGTATTACAGAATCTGGTGATCAGGACCAGGAGTGTTGAATTCATGCCGTTTTGTCTGTCTCTCTCCACCTTCCTAATGAGTGCC
TCTTTCCTTTTGTATGGAATTTTCAGTTCTGATCCCTTTATATATGTGAGTTTTCTTTCTCTCGCTTGGGAATTTCCAATTTTTTCTTTTGTTCTCTCGC
CCGACTCACAAGGATTTTACTTAAATN
>LE_HBa0022P08_T7_133972 (trimmed for quality and cloning vector)
AGCTTTTCATCCTTCATTTTGATTTTCGCTCTTGGATAATGTAGAAAACAAAGTTCACCTTGACCAATTTTTTCGTTGTCCACAATCCAGTATCATTTAT
CTTTATTTTCAGGCCTACATTCATGAGAATAATGAGGAATCAATCAACTGAACAGTTCTCAGGGTTGCCGTACATCTATGGTCTATTGAACTGCTTAATT
TGTGCCTGGTATGGCACCCCTCTCGTATCTCCCGACAATTTGTTGGTTACATCAGTTAATTCAGTTGGTGCTGTTTTTCAACTTGCCTACATTGTACTTT
ACGTAACGTATACAGAGAAAGAGAAAAAGGTTAATACTCTTCTGTTGTATTATTTAATTAATAAAGCAGTTTCACACTCATTCATAGCGTAATCTGTTAA
TCCGTATGCCCATCAATGTTGTTTGTAGTTCAGGATGTTTGGATGGATACTCACAGTCTTTGGCCTATTTGTTATTATTGTACTTGGAAGCTTGTTTATA
CTTGATCTGGAACTCCGACGCATCATCATTGGCTCCCTGAGTTGTGCTTCCTTGATATCAATGTTTGCCTCCCCACTGTTAATTATTGTATGTCTAACCG
TTGACATTCAGAATTTTCTATCAAGTTCTTGTTCTCTAACGTTTTTCCGCGGATTCACTGACTAACTTGTATTACAGAATCTGGTGATCAGGACCAGGAG
TGTTGAATTCATGCCGTTTTGTCTGTCTCTCTCCACCTTCCTAATGAGTGCCTCTTTCCTTTTGTATGGAATTTTCAGTTCTGATCCCTTTATATATGTG
AGTTTTCTTTCTCTCGCTTGGGA

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.955815
Expected error %
0.3979
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At3g14770.1 Score 193 E Value 1e-49 Identity 15.90% Align. Length 683bp (82.99%) Frame 1
68416.m01867 nodulin MtN3 family protein similar to MtN3 GI:1619602 (root nodule development) from [Medicago truncatula]
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At1g21460.1 Score 132 E Value 2e-31 Identity 11.10% Align. Length 737bp (89.55%) Frame 1
68414.m02683 nodulin MtN3 family protein contains similarity to MTN3 (nodule development protein) GB:Y08726 GI:1619601 from [Medicago truncatula]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
dbj|BAB02642.1| Score 193 E Value 5e-48 Identity 15.90% Align. Length 683bp (82.99%) Frame 1
MtN3-like protein [Arabidopsis thaliana] gb|AAL47411.1| AT3g14770/T21E2_2 [Arabidopsis thaliana] gb|AAL06889.1| AT3g14770/T21E2_2 [Arabidopsis thaliana] ref|NP_566493.1| nodulin MtN3 family protein [Arabidopsis thaliana]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
dbj|BAD88223.1| Score 162 E Value 8e-39 Identity 14.10% Align. Length 686bp (83.35%) Frame 1
putative MtN3 [Oryza sativa (japonica cultivar-group)]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0022P08
Clone
Clone name
hba-22p8
LE_HBa0022P08
C07HBa0022P08
P022P08
Clone type
BAC
Contamination
none
Estimated length
85,446
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found