Clone Read LE_HBa0023C06_T7_134112

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0023C06_T7_134112
Primer
T7
ID from Seq. Facility
LE_HBa_023_C06-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
727 trimmed for vector and quality, 919 raw
Genbank Accession
Sequence
>LE_HBa0023C06_T7_134112 (raw untrimmed)
CGGGGACCCGGGGGATCTCTAGAGTCGACCTGCAGGCATGCAAGCTTGGGGATTTTAAATTCAAGATGTGTAATGTATAAAATGATCATTTAGTGACATC
TCCTTTAAATATATTAAAAAGGAAAAAATAAGATAAAATAAAGATGACACTATAGTTAAATTAACTAGCAACATTGACTTTTGGTATATCGAAAAATCAT
TTTTCCAAAAAAATATATCTCAACAATTATTTTCTAAAATAAATTTCGTATAGTTGATTAGTGAGTGAACATATATTGTTAGTAAATTAGATAATGCCTC
GTACGAGAATATTTAAGTAATAAATATCGAAAATAATTTTTTTTAAAAAAACATTATTTGGCAATCCAGTAGCAGAAAATCGATTTATTTCTAAGCATAT
TGCTGAATTTATATAATTAAATTTGTAATAATTAAAAAATCATCTAATATTTTTTCAAAATTATAAAAAAAAAACGAAAACCTGTTAAATTCGTACTTAA
TGGTAGAAAAAGAAATCAAAAAGAAAAAATTTAATCAGAGTTTCTATCTTCCCCTTTTCTTTCTTCATTTTATTTTGGTGTGGGAATTTCCAGTTCAGGG
CTAGGGTTTAAGGTACAGGGAAACAGGGTAAAATCGGAGATGGCGATGACACAGTGGTGCAGCACAGTAGCGAGGAGACTGATGACTGTTATGGAGCAAC
GAATGGCATATTCATCTTCAGCTGCTCCGTCGGCGGCGATGGGAGGTCCGATCCTTTGCGGACGAGGGGGACAGAGGACGAAGAAAGGGAAAAGATTCAA
AGATTCGTATTGGAAATTTCAAAACCTAAAAAGGGAAAAAAAAATTGAACGCCATCAAAGGGAAAAGGTTGAAGGTCCCCCGAGGTCTAACCCCCTGTGG
CCCCCTTCCCTTTTTCAAA
>LE_HBa0023C06_T7_134112 (trimmed for quality and cloning vector)
AGCTTGGGGATTTTAAATTCAAGATGTGTAATGTATAAAATGATCATTTAGTGACATCTCCTTTAAATATATTAAAAAGGAAAAAATAAGATAAAATAAA
GATGACACTATAGTTAAATTAACTAGCAACATTGACTTTTGGTATATCGAAAAATCATTTTTCCAAAAAAATATATCTCAACAATTATTTTCTAAAATAA
ATTTCGTATAGTTGATTAGTGAGTGAACATATATTGTTAGTAAATTAGATAATGCCTCGTACGAGAATATTTAAGTAATAAATATCGAAAATAATTTTTT
TTAAAAAAACATTATTTGGCAATCCAGTAGCAGAAAATCGATTTATTTCTAAGCATATTGCTGAATTTATATAATTAAATTTGTAATAATTAAAAAATCA
TCTAATATTTTTTCAAAATTATAAAAAAAAAACGAAAACCTGTTAAATTCGTACTTAATGGTAGAAAAAGAAATCAAAAAGAAAAAATTTAATCAGAGTT
TCTATCTTCCCCTTTTCTTTCTTCATTTTATTTTGGTGTGGGAATTTCCAGTTCAGGGCTAGGGTTTAAGGTACAGGGAAACAGGGTAAAATCGGAGATG
GCGATGACACAGTGGTGCAGCACAGTAGCGAGGAGACTGATGACTGTTATGGAGCAACGAATGGCATATTCATCTTCAGCTGCTCCGTCGGCGGCGATGG
GAGGTCCGATCCTTTGCGGACGAGGGG

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.927186
Expected error %
0.4044
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0023C06
Clone
Clone name
hba-23c6
LE_HBa0023C06
C01HBa0023C06
P023C06
Clone type
BAC
Contamination
none
Estimated length
31,696
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found