Clone Read LE_HBa0023M04_SP6_134587

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0023M04_SP6_134587
Primer
SP6
ID from Seq. Facility
LE_HBa_023_M04-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
664 trimmed for vector and quality, 827 raw
Genbank Accession
Sequence
>LE_HBa0023M04_SP6_134587 (raw untrimmed)
AATTTCCCTTGCAGGNCATTAANGGGGGCATTCTTCATAAGATCCACCTTGCTATAGGGTCCAACACCACTTTATTGTTATCATCCTGTCCCTATAGAAG
TATTCCTTTAGTGACTCATCATCAATACGGTGATTTGGGACACTTCTCAAGAATGAGGTGAATCTATCCCAAGAACTACTAACTGACTCTCCTGGTAGTG
CCACAAAGTTATTCACCCTGTCTTTGTGGTTTAATTTCTTAGAGACTGGATAGTAGCGTGCTAAGAAGACATCCCGCAGTTGGTTCCAAGTGAAAATGGA
GTTGTATGCGAGCTCAGTAAACCACATAGCAGCCTCTCCCATCAGTGAGAGAGGAAACACTCTGAGACCTATTACATCTAGATCCAAATCAGGCCTCCCC
ACACAACTTTTACACACTGCCCTTACCTTAGCTATATGGGCATGTGGATCCCCAGAAGGTAGCCCTGAAAACAAACCTTTGGCAGTGAGCATTTGCATCA
GACTACTAGTTACCACAAAAGTGTGGCCTGTGGGTAGAGGAGGCAAAACCAGTGGCCCATCCGAATCTGCTATGTTATCATAGCCTCTGTAGTATGCTTG
GGGCCGTGGAGCGGGATTCTGTCCCCTCTGTTGATGTTCACCCTGAGCATCGAGTAACATCTAACCATGAACATCAGCCGGAGCTGGGATGTTCTTGTTT
GGATCCTCATCATTGATTCCCAAATTACGATTCATGTTTCCCAATGTACTTTCTAGCTCGTGATCGTAGGGGAACCACGGTTTTTTTCCCTCTCCTTGTT
TTTGGGCTACAAGGAAGGAAAATTCTG
>LE_HBa0023M04_SP6_134587 (trimmed for quality and cloning vector)
CATTCTTCATAAGATCCACCTTGCTATAGGGTCCAACACCACTTTATTGTTATCATCCTGTCCCTATAGAAGTATTCCTTTAGTGACTCATCATCAATAC
GGTGATTTGGGACACTTCTCAAGAATGAGGTGAATCTATCCCAAGAACTACTAACTGACTCTCCTGGTAGTGCCACAAAGTTATTCACCCTGTCTTTGTG
GTTTAATTTCTTAGAGACTGGATAGTAGCGTGCTAAGAAGACATCCCGCAGTTGGTTCCAAGTGAAAATGGAGTTGTATGCGAGCTCAGTAAACCACATA
GCAGCCTCTCCCATCAGTGAGAGAGGAAACACTCTGAGACCTATTACATCTAGATCCAAATCAGGCCTCCCCACACAACTTTTACACACTGCCCTTACCT
TAGCTATATGGGCATGTGGATCCCCAGAAGGTAGCCCTGAAAACAAACCTTTGGCAGTGAGCATTTGCATCAGACTACTAGTTACCACAAAAGTGTGGCC
TGTGGGTAGAGGAGGCAAAACCAGTGGCCCATCCGAATCTGCTATGTTATCATAGCCTCTGTAGTATGCTTGGGGCCGTGGAGCGGGATTCTGTCCCCTC
TGTTGATGTTCACCCTGAGCATCGAGTAACATCTAACCATGAACATCAGCCGGAGCTGGGATGT

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.984416
Expected error %
0.2231
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT38730.1| Score 146 E Value 5e-34 Identity 17.90% Align. Length 419bp (63.10%) Frame 1
putative reverse transcriptase [Solanum demissum]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAB18645.1| Score 88 E Value 2e-16 Identity 9.90% Align. Length 452bp (68.07%) Frame 1
unknown [Hordeum vulgare] pir||T06196 hypothetical protein - barley
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0023M04
Clone
Clone name
hba-23m4
LE_HBa0023M04
C07HBa0023M04
P023M04
Clone type
BAC
Contamination
none
Estimated length
129,091
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found