Clone Read LE_HBa0023M04_T7_134588

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0023M04_T7_134588
Primer
T7
ID from Seq. Facility
LE_HBa_023_M04-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
731 trimmed for vector and quality, 867 raw
Genbank Accession
Sequence
>LE_HBa0023M04_T7_134588 (raw untrimmed)
CCCGGACCCGAGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTATCTTTATAAGAAACATGTATGACTTTTTTGGGTGGTTAATCTAGTTTGTTA
GTCATCAATGTTGTTTAATTAATATATTTACTAATGGTATACATCATTAAATTGTGTTATTTGTATATGATATAATGTGATAAGTACATATTAATTGAAA
TAAATAAATAATTGACGAATATTATTGTTAGAGCTTGTTGTTTAATTACTTTATAAATAGTGAACATGATGAACAAATTACTTGGGTAAAGGGTTTGAAA
TATATTTGAAATTTGACCGAAAATGTTGTAACAATCTCAAAATTTTGGGCATTACTTATTACCCCCTGCACTACATATTAGTGTATTTTAAAGATATATA
GGTGCCCATGTGGACATTAAATTTTGCATTATTATAAATACTAACTTATCTAGCTAAACACTTATACATCTTTAGATTACATTTTTAAATAATGGATTTG
AGTAATAGTCCTACCCAATGTTTGGGAATGTTAAAACAACTTGAGTCAAAGTTAAGATATATTTCATATCTTTTTCCCAAATTACTTTTTTCGTAGTTAA
AGGTATATATTTGTATGTTTAGACTCTCAAGTACTCTGATTAAGAATTTTTAGCTGTCTATTATAGATTAAAAGGATTAATAATAATAATAATAATAATA
ATAATAATAATAATAATAATAATATGTTATACTATCTATTAAAAGAAAGGGGGGCCAGATGTCCAATCGCTCTGTTAAATTTTTGAGTTTTCGATAATTA
ACAACATTAAAATAATTGTTACTAGGAAATGAATAATGATTTCCACGCCCTTGAGGGCTAAACTCCC
>LE_HBa0023M04_T7_134588 (trimmed for quality and cloning vector)
AGCTTATCTTTATAAGAAACATGTATGACTTTTTTGGGTGGTTAATCTAGTTTGTTAGTCATCAATGTTGTTTAATTAATATATTTACTAATGGTATACA
TCATTAAATTGTGTTATTTGTATATGATATAATGTGATAAGTACATATTAATTGAAATAAATAAATAATTGACGAATATTATTGTTAGAGCTTGTTGTTT
AATTACTTTATAAATAGTGAACATGATGAACAAATTACTTGGGTAAAGGGTTTGAAATATATTTGAAATTTGACCGAAAATGTTGTAACAATCTCAAAAT
TTTGGGCATTACTTATTACCCCCTGCACTACATATTAGTGTATTTTAAAGATATATAGGTGCCCATGTGGACATTAAATTTTGCATTATTATAAATACTA
ACTTATCTAGCTAAACACTTATACATCTTTAGATTACATTTTTAAATAATGGATTTGAGTAATAGTCCTACCCAATGTTTGGGAATGTTAAAACAACTTG
AGTCAAAGTTAAGATATATTTCATATCTTTTTCCCAAATTACTTTTTTCGTAGTTAAAGGTATATATTTGTATGTTTAGACTCTCAAGTACTCTGATTAA
GAATTTTTAGCTGTCTATTATAGATTAAAAGGATTAATAATAATAATAATAATAATAATAATAATAATAATAATAATAATATGTTATACTATCTATTAAA
AGAAAGGGGGGCCAGATGTCCAATCGCTCTG

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.891527
Expected error %
0.7879
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0023M04
Clone
Clone name
hba-23m4
LE_HBa0023M04
C07HBa0023M04
P023M04
Clone type
BAC
Contamination
none
Estimated length
129,091
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found